ID: 926822619

View in Genome Browser
Species Human (GRCh38)
Location 2:16869865-16869887
Sequence CAGAGTGTGAATGCTCTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926822619_926822621 -6 Left 926822619 2:16869865-16869887 CCAGCAAGAGCATTCACACTCTG No data
Right 926822621 2:16869882-16869904 ACTCTGGCTCCTACGCCACCAGG No data
926822619_926822622 -1 Left 926822619 2:16869865-16869887 CCAGCAAGAGCATTCACACTCTG No data
Right 926822622 2:16869887-16869909 GGCTCCTACGCCACCAGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926822619 Original CRISPR CAGAGTGTGAATGCTCTTGC TGG (reversed) Intergenic
No off target data available for this crispr