ID: 926822729

View in Genome Browser
Species Human (GRCh38)
Location 2:16871074-16871096
Sequence TGCTCCACGCAGGTTTCTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926822726_926822729 23 Left 926822726 2:16871028-16871050 CCATTAACAGTTTCTAGAAATAG No data
Right 926822729 2:16871074-16871096 TGCTCCACGCAGGTTTCTATAGG No data
926822725_926822729 26 Left 926822725 2:16871025-16871047 CCTCCATTAACAGTTTCTAGAAA No data
Right 926822729 2:16871074-16871096 TGCTCCACGCAGGTTTCTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926822729 Original CRISPR TGCTCCACGCAGGTTTCTAT AGG Intergenic
No off target data available for this crispr