ID: 926824699

View in Genome Browser
Species Human (GRCh38)
Location 2:16892887-16892909
Sequence AAACTCTGCTTCACAAACAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926824699_926824701 16 Left 926824699 2:16892887-16892909 CCTATGTTTGTGAAGCAGAGTTT No data
Right 926824701 2:16892926-16892948 CCAAAATGAGATTATGTAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926824699 Original CRISPR AAACTCTGCTTCACAAACAT AGG (reversed) Intergenic