ID: 926825164

View in Genome Browser
Species Human (GRCh38)
Location 2:16898903-16898925
Sequence AAGGATAAGCAGATGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926825157_926825164 18 Left 926825157 2:16898862-16898884 CCTGCACCAATCCTCTACATGAT No data
Right 926825164 2:16898903-16898925 AAGGATAAGCAGATGGAGGCTGG No data
926825154_926825164 30 Left 926825154 2:16898850-16898872 CCTGCAGCTTCCCCTGCACCAAT No data
Right 926825164 2:16898903-16898925 AAGGATAAGCAGATGGAGGCTGG No data
926825156_926825164 19 Left 926825156 2:16898861-16898883 CCCTGCACCAATCCTCTACATGA No data
Right 926825164 2:16898903-16898925 AAGGATAAGCAGATGGAGGCTGG No data
926825155_926825164 20 Left 926825155 2:16898860-16898882 CCCCTGCACCAATCCTCTACATG No data
Right 926825164 2:16898903-16898925 AAGGATAAGCAGATGGAGGCTGG No data
926825158_926825164 12 Left 926825158 2:16898868-16898890 CCAATCCTCTACATGATTCTGAC No data
Right 926825164 2:16898903-16898925 AAGGATAAGCAGATGGAGGCTGG No data
926825159_926825164 7 Left 926825159 2:16898873-16898895 CCTCTACATGATTCTGACTCTGC No data
Right 926825164 2:16898903-16898925 AAGGATAAGCAGATGGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926825164 Original CRISPR AAGGATAAGCAGATGGAGGC TGG Intergenic
No off target data available for this crispr