ID: 926825783

View in Genome Browser
Species Human (GRCh38)
Location 2:16903772-16903794
Sequence AGGGTCTCCTTGGGAAAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926825777_926825783 -6 Left 926825777 2:16903755-16903777 CCCTGGTAAAAGGCCGGAGGGTC No data
Right 926825783 2:16903772-16903794 AGGGTCTCCTTGGGAAAGATGGG No data
926825778_926825783 -7 Left 926825778 2:16903756-16903778 CCTGGTAAAAGGCCGGAGGGTCT No data
Right 926825783 2:16903772-16903794 AGGGTCTCCTTGGGAAAGATGGG No data
926825771_926825783 9 Left 926825771 2:16903740-16903762 CCCAATGCACAGTAACCCTGGTA No data
Right 926825783 2:16903772-16903794 AGGGTCTCCTTGGGAAAGATGGG No data
926825772_926825783 8 Left 926825772 2:16903741-16903763 CCAATGCACAGTAACCCTGGTAA No data
Right 926825783 2:16903772-16903794 AGGGTCTCCTTGGGAAAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926825783 Original CRISPR AGGGTCTCCTTGGGAAAGAT GGG Intergenic
No off target data available for this crispr