ID: 926826763

View in Genome Browser
Species Human (GRCh38)
Location 2:16913675-16913697
Sequence GACAGATCTTGGCCTGTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926826759_926826763 10 Left 926826759 2:16913642-16913664 CCACCTTCTGCAGATACTACTCT No data
Right 926826763 2:16913675-16913697 GACAGATCTTGGCCTGTTACTGG No data
926826760_926826763 7 Left 926826760 2:16913645-16913667 CCTTCTGCAGATACTACTCTCCT No data
Right 926826763 2:16913675-16913697 GACAGATCTTGGCCTGTTACTGG No data
926826758_926826763 15 Left 926826758 2:16913637-16913659 CCATGCCACCTTCTGCAGATACT No data
Right 926826763 2:16913675-16913697 GACAGATCTTGGCCTGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926826763 Original CRISPR GACAGATCTTGGCCTGTTAC TGG Intergenic
No off target data available for this crispr