ID: 926826860

View in Genome Browser
Species Human (GRCh38)
Location 2:16914375-16914397
Sequence CCTCCACTGAGGTCACCCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926826860_926826865 3 Left 926826860 2:16914375-16914397 CCAGCGGGTGACCTCAGTGGAGG No data
Right 926826865 2:16914401-16914423 AATTTAATAATAAAGTGGATAGG No data
926826860_926826864 -2 Left 926826860 2:16914375-16914397 CCAGCGGGTGACCTCAGTGGAGG No data
Right 926826864 2:16914396-16914418 GGTGGAATTTAATAATAAAGTGG No data
926826860_926826866 19 Left 926826860 2:16914375-16914397 CCAGCGGGTGACCTCAGTGGAGG No data
Right 926826866 2:16914417-16914439 GGATAGGATGACTTATTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926826860 Original CRISPR CCTCCACTGAGGTCACCCGC TGG (reversed) Intergenic
No off target data available for this crispr