ID: 926826864

View in Genome Browser
Species Human (GRCh38)
Location 2:16914396-16914418
Sequence GGTGGAATTTAATAATAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926826857_926826864 13 Left 926826857 2:16914360-16914382 CCATGTGAGTGATCACCAGCGGG No data
Right 926826864 2:16914396-16914418 GGTGGAATTTAATAATAAAGTGG No data
926826860_926826864 -2 Left 926826860 2:16914375-16914397 CCAGCGGGTGACCTCAGTGGAGG No data
Right 926826864 2:16914396-16914418 GGTGGAATTTAATAATAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926826864 Original CRISPR GGTGGAATTTAATAATAAAG TGG Intergenic
No off target data available for this crispr