ID: 926826865

View in Genome Browser
Species Human (GRCh38)
Location 2:16914401-16914423
Sequence AATTTAATAATAAAGTGGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926826857_926826865 18 Left 926826857 2:16914360-16914382 CCATGTGAGTGATCACCAGCGGG No data
Right 926826865 2:16914401-16914423 AATTTAATAATAAAGTGGATAGG No data
926826863_926826865 -8 Left 926826863 2:16914386-16914408 CCTCAGTGGAGGTGGAATTTAAT No data
Right 926826865 2:16914401-16914423 AATTTAATAATAAAGTGGATAGG No data
926826860_926826865 3 Left 926826860 2:16914375-16914397 CCAGCGGGTGACCTCAGTGGAGG No data
Right 926826865 2:16914401-16914423 AATTTAATAATAAAGTGGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926826865 Original CRISPR AATTTAATAATAAAGTGGAT AGG Intergenic
No off target data available for this crispr