ID: 926826866

View in Genome Browser
Species Human (GRCh38)
Location 2:16914417-16914439
Sequence GGATAGGATGACTTATTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926826860_926826866 19 Left 926826860 2:16914375-16914397 CCAGCGGGTGACCTCAGTGGAGG No data
Right 926826866 2:16914417-16914439 GGATAGGATGACTTATTCTGTGG No data
926826863_926826866 8 Left 926826863 2:16914386-16914408 CCTCAGTGGAGGTGGAATTTAAT No data
Right 926826866 2:16914417-16914439 GGATAGGATGACTTATTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926826866 Original CRISPR GGATAGGATGACTTATTCTG TGG Intergenic
No off target data available for this crispr