ID: 926829928

View in Genome Browser
Species Human (GRCh38)
Location 2:16950583-16950605
Sequence TCTTATCTTTACAAGTTGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926829928_926829930 7 Left 926829928 2:16950583-16950605 CCAAACAACTTGTAAAGATAAGA No data
Right 926829930 2:16950613-16950635 AAATGCACTGCATCCAAGAAGGG No data
926829928_926829929 6 Left 926829928 2:16950583-16950605 CCAAACAACTTGTAAAGATAAGA No data
Right 926829929 2:16950612-16950634 CAAATGCACTGCATCCAAGAAGG No data
926829928_926829932 26 Left 926829928 2:16950583-16950605 CCAAACAACTTGTAAAGATAAGA No data
Right 926829932 2:16950632-16950654 AGGGCCAAGAAGATAATGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926829928 Original CRISPR TCTTATCTTTACAAGTTGTT TGG (reversed) Intergenic
No off target data available for this crispr