ID: 926830946

View in Genome Browser
Species Human (GRCh38)
Location 2:16961133-16961155
Sequence CTAAACAACAAGATAATTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926830946_926830949 -5 Left 926830946 2:16961133-16961155 CCATTAATTATCTTGTTGTTTAG No data
Right 926830949 2:16961151-16961173 TTTAGGTGAGTCAAGTGTCTGGG No data
926830946_926830948 -6 Left 926830946 2:16961133-16961155 CCATTAATTATCTTGTTGTTTAG No data
Right 926830948 2:16961150-16961172 GTTTAGGTGAGTCAAGTGTCTGG No data
926830946_926830952 10 Left 926830946 2:16961133-16961155 CCATTAATTATCTTGTTGTTTAG No data
Right 926830952 2:16961166-16961188 TGTCTGGGCAAGGCTTGCCTGGG No data
926830946_926830951 9 Left 926830946 2:16961133-16961155 CCATTAATTATCTTGTTGTTTAG No data
Right 926830951 2:16961165-16961187 GTGTCTGGGCAAGGCTTGCCTGG No data
926830946_926830950 0 Left 926830946 2:16961133-16961155 CCATTAATTATCTTGTTGTTTAG No data
Right 926830950 2:16961156-16961178 GTGAGTCAAGTGTCTGGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926830946 Original CRISPR CTAAACAACAAGATAATTAA TGG (reversed) Intergenic
No off target data available for this crispr