ID: 926830949

View in Genome Browser
Species Human (GRCh38)
Location 2:16961151-16961173
Sequence TTTAGGTGAGTCAAGTGTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926830946_926830949 -5 Left 926830946 2:16961133-16961155 CCATTAATTATCTTGTTGTTTAG No data
Right 926830949 2:16961151-16961173 TTTAGGTGAGTCAAGTGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926830949 Original CRISPR TTTAGGTGAGTCAAGTGTCT GGG Intergenic
No off target data available for this crispr