ID: 926831026

View in Genome Browser
Species Human (GRCh38)
Location 2:16962057-16962079
Sequence CCCTTTTATCTCATCTTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926831026_926831032 -10 Left 926831026 2:16962057-16962079 CCACCAAAGATGAGATAAAAGGG No data
Right 926831032 2:16962070-16962092 GATAAAAGGGGAAAGGATGAGGG No data
926831026_926831033 -9 Left 926831026 2:16962057-16962079 CCACCAAAGATGAGATAAAAGGG No data
Right 926831033 2:16962071-16962093 ATAAAAGGGGAAAGGATGAGGGG No data
926831026_926831035 25 Left 926831026 2:16962057-16962079 CCACCAAAGATGAGATAAAAGGG No data
Right 926831035 2:16962105-16962127 TCCCACCCTTTATTGCCCAGAGG No data
926831026_926831034 -8 Left 926831026 2:16962057-16962079 CCACCAAAGATGAGATAAAAGGG No data
Right 926831034 2:16962072-16962094 TAAAAGGGGAAAGGATGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926831026 Original CRISPR CCCTTTTATCTCATCTTTGG TGG (reversed) Intergenic
No off target data available for this crispr