ID: 926841430

View in Genome Browser
Species Human (GRCh38)
Location 2:17084950-17084972
Sequence ATGGAGAAGTAGATGGGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926841430_926841437 17 Left 926841430 2:17084950-17084972 CCATCTCCCATCTACTTCTCCAT No data
Right 926841437 2:17084990-17085012 TGACTTTTCTCATTAAATGTAGG No data
926841430_926841434 -8 Left 926841430 2:17084950-17084972 CCATCTCCCATCTACTTCTCCAT No data
Right 926841434 2:17084965-17084987 TTCTCCATGTGGCCTATTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926841430 Original CRISPR ATGGAGAAGTAGATGGGAGA TGG (reversed) Intergenic
No off target data available for this crispr