ID: 926843515

View in Genome Browser
Species Human (GRCh38)
Location 2:17108013-17108035
Sequence TGGTGACAGGCAGTCAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926843507_926843515 14 Left 926843507 2:17107976-17107998 CCTGCGAGACCAACAGCAGGGAA No data
Right 926843515 2:17108013-17108035 TGGTGACAGGCAGTCAAGGAAGG No data
926843508_926843515 5 Left 926843508 2:17107985-17108007 CCAACAGCAGGGAAGAACCTAAA No data
Right 926843515 2:17108013-17108035 TGGTGACAGGCAGTCAAGGAAGG No data
926843506_926843515 15 Left 926843506 2:17107975-17107997 CCCTGCGAGACCAACAGCAGGGA No data
Right 926843515 2:17108013-17108035 TGGTGACAGGCAGTCAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926843515 Original CRISPR TGGTGACAGGCAGTCAAGGA AGG Intergenic
No off target data available for this crispr