ID: 926844033

View in Genome Browser
Species Human (GRCh38)
Location 2:17113956-17113978
Sequence TGTCCATTGTTTACAACATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926844033_926844036 0 Left 926844033 2:17113956-17113978 CCTCATGTTGTAAACAATGGACA No data
Right 926844036 2:17113979-17114001 GGAAGACAGTGGATTCAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926844033 Original CRISPR TGTCCATTGTTTACAACATG AGG (reversed) Intergenic
No off target data available for this crispr