ID: 926844666

View in Genome Browser
Species Human (GRCh38)
Location 2:17123237-17123259
Sequence GTAGTGTTGTAACCAAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926844665_926844666 -5 Left 926844665 2:17123219-17123241 CCAAAAAGCACAGAGTGAGTAGT No data
Right 926844666 2:17123237-17123259 GTAGTGTTGTAACCAAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926844666 Original CRISPR GTAGTGTTGTAACCAAAAGC AGG Intergenic
No off target data available for this crispr