ID: 926845498

View in Genome Browser
Species Human (GRCh38)
Location 2:17133223-17133245
Sequence CAAGTGGCCCACCTTTATCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926845492_926845498 11 Left 926845492 2:17133189-17133211 CCCTTAATCTAGGCAAACCATTT No data
Right 926845498 2:17133223-17133245 CAAGTGGCCCACCTTTATCACGG No data
926845495_926845498 -6 Left 926845495 2:17133206-17133228 CCATTTGACATGCTGGCCAAGTG No data
Right 926845498 2:17133223-17133245 CAAGTGGCCCACCTTTATCACGG No data
926845493_926845498 10 Left 926845493 2:17133190-17133212 CCTTAATCTAGGCAAACCATTTG No data
Right 926845498 2:17133223-17133245 CAAGTGGCCCACCTTTATCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926845498 Original CRISPR CAAGTGGCCCACCTTTATCA CGG Intergenic
No off target data available for this crispr