ID: 926848553

View in Genome Browser
Species Human (GRCh38)
Location 2:17169334-17169356
Sequence CACACAGAGCACTTTGAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926848551_926848553 5 Left 926848551 2:17169306-17169328 CCATGCCTGGTATAGAGGATCGC No data
Right 926848553 2:17169334-17169356 CACACAGAGCACTTTGAGCTTGG No data
926848552_926848553 0 Left 926848552 2:17169311-17169333 CCTGGTATAGAGGATCGCATGAA No data
Right 926848553 2:17169334-17169356 CACACAGAGCACTTTGAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926848553 Original CRISPR CACACAGAGCACTTTGAGCT TGG Intergenic
No off target data available for this crispr