ID: 926848561

View in Genome Browser
Species Human (GRCh38)
Location 2:17169402-17169424
Sequence TTGAACATTTGGAGGATTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926848557_926848561 10 Left 926848557 2:17169369-17169391 CCATGGTGTGTGTGAAGGAGTTT No data
Right 926848561 2:17169402-17169424 TTGAACATTTGGAGGATTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926848561 Original CRISPR TTGAACATTTGGAGGATTAT TGG Intergenic
No off target data available for this crispr