ID: 926851107

View in Genome Browser
Species Human (GRCh38)
Location 2:17198294-17198316
Sequence GCTTCCTTGAAAATTACCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926851106_926851107 2 Left 926851106 2:17198269-17198291 CCAAGGTGTAAGGCACAGGGTCA No data
Right 926851107 2:17198294-17198316 GCTTCCTTGAAAATTACCCAAGG No data
926851102_926851107 13 Left 926851102 2:17198258-17198280 CCACTGTGGCTCCAAGGTGTAAG No data
Right 926851107 2:17198294-17198316 GCTTCCTTGAAAATTACCCAAGG No data
926851096_926851107 30 Left 926851096 2:17198241-17198263 CCCTTACCACCTCAGATCCACTG No data
Right 926851107 2:17198294-17198316 GCTTCCTTGAAAATTACCCAAGG No data
926851100_926851107 21 Left 926851100 2:17198250-17198272 CCTCAGATCCACTGTGGCTCCAA No data
Right 926851107 2:17198294-17198316 GCTTCCTTGAAAATTACCCAAGG No data
926851097_926851107 29 Left 926851097 2:17198242-17198264 CCTTACCACCTCAGATCCACTGT No data
Right 926851107 2:17198294-17198316 GCTTCCTTGAAAATTACCCAAGG No data
926851099_926851107 24 Left 926851099 2:17198247-17198269 CCACCTCAGATCCACTGTGGCTC No data
Right 926851107 2:17198294-17198316 GCTTCCTTGAAAATTACCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926851107 Original CRISPR GCTTCCTTGAAAATTACCCA AGG Intergenic
No off target data available for this crispr