ID: 926854195

View in Genome Browser
Species Human (GRCh38)
Location 2:17234538-17234560
Sequence CTGTACTTCTAGAAGTATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926854190_926854195 12 Left 926854190 2:17234503-17234525 CCAGGACCCTCATTCAAGACAGG No data
Right 926854195 2:17234538-17234560 CTGTACTTCTAGAAGTATCTTGG No data
926854189_926854195 13 Left 926854189 2:17234502-17234524 CCCAGGACCCTCATTCAAGACAG No data
Right 926854195 2:17234538-17234560 CTGTACTTCTAGAAGTATCTTGG No data
926854193_926854195 6 Left 926854193 2:17234509-17234531 CCCTCATTCAAGACAGGAGGTTT No data
Right 926854195 2:17234538-17234560 CTGTACTTCTAGAAGTATCTTGG No data
926854194_926854195 5 Left 926854194 2:17234510-17234532 CCTCATTCAAGACAGGAGGTTTA No data
Right 926854195 2:17234538-17234560 CTGTACTTCTAGAAGTATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926854195 Original CRISPR CTGTACTTCTAGAAGTATCT TGG Intergenic
No off target data available for this crispr