ID: 926857253

View in Genome Browser
Species Human (GRCh38)
Location 2:17270638-17270660
Sequence ACAACCTACTCGGCCATTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926857253_926857258 -6 Left 926857253 2:17270638-17270660 CCAGTAATGGCCGAGTAGGTTGT No data
Right 926857258 2:17270655-17270677 GGTTGTTTCACTGGTGGCCAGGG No data
926857253_926857257 -7 Left 926857253 2:17270638-17270660 CCAGTAATGGCCGAGTAGGTTGT No data
Right 926857257 2:17270654-17270676 AGGTTGTTTCACTGGTGGCCAGG No data
926857253_926857261 27 Left 926857253 2:17270638-17270660 CCAGTAATGGCCGAGTAGGTTGT No data
Right 926857261 2:17270688-17270710 CATGGAAGAAAGCATTGCTCAGG No data
926857253_926857259 9 Left 926857253 2:17270638-17270660 CCAGTAATGGCCGAGTAGGTTGT No data
Right 926857259 2:17270670-17270692 GGCCAGGGTAAACACAGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926857253 Original CRISPR ACAACCTACTCGGCCATTAC TGG (reversed) Intergenic
No off target data available for this crispr