ID: 926857255

View in Genome Browser
Species Human (GRCh38)
Location 2:17270648-17270670
Sequence CACCAGTGAAACAACCTACT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926857255_926857261 17 Left 926857255 2:17270648-17270670 CCGAGTAGGTTGTTTCACTGGTG No data
Right 926857261 2:17270688-17270710 CATGGAAGAAAGCATTGCTCAGG No data
926857255_926857259 -1 Left 926857255 2:17270648-17270670 CCGAGTAGGTTGTTTCACTGGTG No data
Right 926857259 2:17270670-17270692 GGCCAGGGTAAACACAGTCATGG No data
926857255_926857264 28 Left 926857255 2:17270648-17270670 CCGAGTAGGTTGTTTCACTGGTG No data
Right 926857264 2:17270699-17270721 GCATTGCTCAGGTCTGAATGGGG No data
926857255_926857262 26 Left 926857255 2:17270648-17270670 CCGAGTAGGTTGTTTCACTGGTG No data
Right 926857262 2:17270697-17270719 AAGCATTGCTCAGGTCTGAATGG No data
926857255_926857263 27 Left 926857255 2:17270648-17270670 CCGAGTAGGTTGTTTCACTGGTG No data
Right 926857263 2:17270698-17270720 AGCATTGCTCAGGTCTGAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926857255 Original CRISPR CACCAGTGAAACAACCTACT CGG (reversed) Intergenic
No off target data available for this crispr