ID: 926857259

View in Genome Browser
Species Human (GRCh38)
Location 2:17270670-17270692
Sequence GGCCAGGGTAAACACAGTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926857255_926857259 -1 Left 926857255 2:17270648-17270670 CCGAGTAGGTTGTTTCACTGGTG No data
Right 926857259 2:17270670-17270692 GGCCAGGGTAAACACAGTCATGG No data
926857250_926857259 24 Left 926857250 2:17270623-17270645 CCTGTGGAATGTATGCCAGTAAT No data
Right 926857259 2:17270670-17270692 GGCCAGGGTAAACACAGTCATGG No data
926857253_926857259 9 Left 926857253 2:17270638-17270660 CCAGTAATGGCCGAGTAGGTTGT No data
Right 926857259 2:17270670-17270692 GGCCAGGGTAAACACAGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926857259 Original CRISPR GGCCAGGGTAAACACAGTCA TGG Intergenic
No off target data available for this crispr