ID: 926861964

View in Genome Browser
Species Human (GRCh38)
Location 2:17319244-17319266
Sequence CTTCTGCTCTTTAGGAATAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926861964_926861967 -3 Left 926861964 2:17319244-17319266 CCCTTATTCCTAAAGAGCAGAAG No data
Right 926861967 2:17319264-17319286 AAGTTAAGAGTACTCACTGTAGG No data
926861964_926861968 1 Left 926861964 2:17319244-17319266 CCCTTATTCCTAAAGAGCAGAAG No data
Right 926861968 2:17319268-17319290 TAAGAGTACTCACTGTAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926861964 Original CRISPR CTTCTGCTCTTTAGGAATAA GGG (reversed) Intergenic
No off target data available for this crispr