ID: 926862571

View in Genome Browser
Species Human (GRCh38)
Location 2:17324442-17324464
Sequence ATGGATGAGGAGAATGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926862571_926862578 1 Left 926862571 2:17324442-17324464 CCATCCCCATTCTCCTCATCCAT No data
Right 926862578 2:17324466-17324488 AGGCCAAAGAGAATGCTAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926862571 Original CRISPR ATGGATGAGGAGAATGGGGA TGG (reversed) Intergenic
No off target data available for this crispr