ID: 926864982

View in Genome Browser
Species Human (GRCh38)
Location 2:17346308-17346330
Sequence GGCAAAACAGCAGTGGTAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926864982_926864989 24 Left 926864982 2:17346308-17346330 CCATCTACCACTGCTGTTTTGCC No data
Right 926864989 2:17346355-17346377 TCCATTCTTCTGGATCCAGCAGG No data
926864982_926864988 14 Left 926864982 2:17346308-17346330 CCATCTACCACTGCTGTTTTGCC No data
Right 926864988 2:17346345-17346367 ACTGCTGACTTCCATTCTTCTGG No data
926864982_926864991 25 Left 926864982 2:17346308-17346330 CCATCTACCACTGCTGTTTTGCC No data
Right 926864991 2:17346356-17346378 CCATTCTTCTGGATCCAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926864982 Original CRISPR GGCAAAACAGCAGTGGTAGA TGG (reversed) Intergenic
No off target data available for this crispr