ID: 926869447

View in Genome Browser
Species Human (GRCh38)
Location 2:17396882-17396904
Sequence CTCCATATGACACTTCTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926869442_926869447 6 Left 926869442 2:17396853-17396875 CCAGTGGCACCCTTATTCCCTAT No data
Right 926869447 2:17396882-17396904 CTCCATATGACACTTCTTACTGG No data
926869441_926869447 17 Left 926869441 2:17396842-17396864 CCAGCTAAATACCAGTGGCACCC No data
Right 926869447 2:17396882-17396904 CTCCATATGACACTTCTTACTGG No data
926869444_926869447 -4 Left 926869444 2:17396863-17396885 CCTTATTCCCTATACTTTTCTCC No data
Right 926869447 2:17396882-17396904 CTCCATATGACACTTCTTACTGG No data
926869443_926869447 -3 Left 926869443 2:17396862-17396884 CCCTTATTCCCTATACTTTTCTC No data
Right 926869447 2:17396882-17396904 CTCCATATGACACTTCTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926869447 Original CRISPR CTCCATATGACACTTCTTAC TGG Intergenic
No off target data available for this crispr