ID: 926873014

View in Genome Browser
Species Human (GRCh38)
Location 2:17444223-17444245
Sequence GAGGAAAAGGAGAATGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926873008_926873014 12 Left 926873008 2:17444188-17444210 CCAGTGAATGCAATAAAATGAAA No data
Right 926873014 2:17444223-17444245 GAGGAAAAGGAGAATGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926873014 Original CRISPR GAGGAAAAGGAGAATGAGGA AGG Intergenic
No off target data available for this crispr