ID: 926874392

View in Genome Browser
Species Human (GRCh38)
Location 2:17458518-17458540
Sequence AGGAAGAAGCATTATGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926874386_926874392 29 Left 926874386 2:17458466-17458488 CCTAAATTCAATGAGAAGTGTCC No data
Right 926874392 2:17458518-17458540 AGGAAGAAGCATTATGAAGATGG No data
926874390_926874392 8 Left 926874390 2:17458487-17458509 CCTTATAAGGGATAGGAAAGATT No data
Right 926874392 2:17458518-17458540 AGGAAGAAGCATTATGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926874392 Original CRISPR AGGAAGAAGCATTATGAAGA TGG Intergenic
No off target data available for this crispr