ID: 926875397

View in Genome Browser
Species Human (GRCh38)
Location 2:17471139-17471161
Sequence GTTCAGCAGCACAATGCTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926875397_926875400 5 Left 926875397 2:17471139-17471161 CCTACAGCATTGTGCTGCTGAAC No data
Right 926875400 2:17471167-17471189 CTTTAATTTGGCTTCTCCATTGG No data
926875397_926875398 -7 Left 926875397 2:17471139-17471161 CCTACAGCATTGTGCTGCTGAAC No data
Right 926875398 2:17471155-17471177 GCTGAACAGCCACTTTAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926875397 Original CRISPR GTTCAGCAGCACAATGCTGT AGG (reversed) Intergenic
No off target data available for this crispr