ID: 926875400

View in Genome Browser
Species Human (GRCh38)
Location 2:17471167-17471189
Sequence CTTTAATTTGGCTTCTCCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926875394_926875400 29 Left 926875394 2:17471115-17471137 CCAGGGGACCTGTGGAACGTACC 0: 3
1: 4
2: 20
3: 60
4: 131
Right 926875400 2:17471167-17471189 CTTTAATTTGGCTTCTCCATTGG No data
926875397_926875400 5 Left 926875397 2:17471139-17471161 CCTACAGCATTGTGCTGCTGAAC No data
Right 926875400 2:17471167-17471189 CTTTAATTTGGCTTCTCCATTGG No data
926875395_926875400 21 Left 926875395 2:17471123-17471145 CCTGTGGAACGTACCTCCTACAG No data
Right 926875400 2:17471167-17471189 CTTTAATTTGGCTTCTCCATTGG No data
926875396_926875400 8 Left 926875396 2:17471136-17471158 CCTCCTACAGCATTGTGCTGCTG No data
Right 926875400 2:17471167-17471189 CTTTAATTTGGCTTCTCCATTGG No data
926875393_926875400 30 Left 926875393 2:17471114-17471136 CCCAGGGGACCTGTGGAACGTAC 0: 2
1: 8
2: 23
3: 55
4: 97
Right 926875400 2:17471167-17471189 CTTTAATTTGGCTTCTCCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926875400 Original CRISPR CTTTAATTTGGCTTCTCCAT TGG Intergenic
No off target data available for this crispr