ID: 926877471

View in Genome Browser
Species Human (GRCh38)
Location 2:17497814-17497836
Sequence AAGCAGAAGCAGAGTGTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926877471_926877473 11 Left 926877471 2:17497814-17497836 CCTACAACACTCTGCTTCTGCTT No data
Right 926877473 2:17497848-17497870 CACATGCTATTTGGAAATGCTGG No data
926877471_926877474 12 Left 926877471 2:17497814-17497836 CCTACAACACTCTGCTTCTGCTT No data
Right 926877474 2:17497849-17497871 ACATGCTATTTGGAAATGCTGGG No data
926877471_926877472 2 Left 926877471 2:17497814-17497836 CCTACAACACTCTGCTTCTGCTT No data
Right 926877472 2:17497839-17497861 AGTTTATTTCACATGCTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926877471 Original CRISPR AAGCAGAAGCAGAGTGTTGT AGG (reversed) Intergenic
No off target data available for this crispr