ID: 926879027

View in Genome Browser
Species Human (GRCh38)
Location 2:17520279-17520301
Sequence ATTGAAACCACTATTTATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 269}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926879024_926879027 1 Left 926879024 2:17520255-17520277 CCACTGCCATTTCAAACAATGGC 0: 1
1: 0
2: 2
3: 15
4: 158
Right 926879027 2:17520279-17520301 ATTGAAACCACTATTTATGTGGG 0: 1
1: 0
2: 1
3: 16
4: 269
926879025_926879027 -5 Left 926879025 2:17520261-17520283 CCATTTCAAACAATGGCTATTGA 0: 1
1: 0
2: 0
3: 21
4: 205
Right 926879027 2:17520279-17520301 ATTGAAACCACTATTTATGTGGG 0: 1
1: 0
2: 1
3: 16
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926879027 Original CRISPR ATTGAAACCACTATTTATGT GGG Intergenic
906178670 1:43799182-43799204 TTTGAAACCCCTATTTACCTAGG - Intronic
906785014 1:48607675-48607697 TTTGAATCCACTGTTTATGATGG - Intronic
907080262 1:51615483-51615505 ATTGAGACCTCTTTTTGTGTTGG - Intronic
908486784 1:64602732-64602754 ATGTAAACCATTATTTTTGTTGG + Intronic
910659154 1:89652237-89652259 ATTGAAAACAGGATCTATGTGGG + Intronic
910969048 1:92836155-92836177 ATTGAAACCAGCATTTACATTGG + Intronic
915706464 1:157848536-157848558 ATTGATACCATTATTTATAATGG - Intronic
917880968 1:179335508-179335530 ATTGAAGCCATTTTTTATGAAGG + Exonic
918174583 1:182031664-182031686 ATTGAAACCATTATTTCTTTTGG + Intergenic
918271033 1:182899897-182899919 ATTGAAACTACCATTTCAGTGGG + Exonic
918847825 1:189641594-189641616 CTGGAATCCACTATTGATGTTGG + Intergenic
918869209 1:189946429-189946451 ACAGAAAACACTATTTAAGTAGG - Intergenic
919490545 1:198200118-198200140 ATTAAAACCAATATTTAATTAGG + Intronic
919873692 1:201845001-201845023 ATTGATACCAGTATTTTTTTTGG + Intronic
920863241 1:209729041-209729063 ATTGAATCCACTATTATTTTAGG - Intronic
921548405 1:216501801-216501823 AATGAAACCACAATCTCTGTGGG + Intergenic
921848938 1:219913527-219913549 ATTTCAACCAATGTTTATGTAGG + Intronic
922426230 1:225498015-225498037 AATGAAAACACTGATTATGTGGG + Intronic
922844772 1:228676061-228676083 CTTGAAGCCACTTGTTATGTGGG - Intergenic
923533140 1:234827482-234827504 TTTGAACCCACTTCTTATGTTGG - Intergenic
923748868 1:236728095-236728117 AGTGAAACCTCTATTTTTGCGGG + Intronic
1063956330 10:11270939-11270961 ATTGAAATCAGCATTTATGCAGG + Intronic
1065264716 10:23963076-23963098 TATGAAACCATTATTTTTGTAGG - Intronic
1067320159 10:45211300-45211322 ATAGAAAACACTTATTATGTAGG + Intergenic
1067330376 10:45310227-45310249 AATGAAGCCACTATATATTTAGG - Intronic
1068234931 10:54221201-54221223 TTGGCAACCACTAATTATGTTGG - Intronic
1069422923 10:68262720-68262742 ATTGTAACCACCATTGTTGTGGG + Intergenic
1072272408 10:93789580-93789602 ATTTAAACAACACTTTATGTTGG - Intronic
1072326546 10:94304540-94304562 ATTGAAACCTCCAGTTCTGTGGG + Exonic
1075436013 10:122442761-122442783 ATGGACACCACTATTTATAAAGG + Intergenic
1075692527 10:124407950-124407972 ATTCAAACCACAGTCTATGTAGG + Intronic
1078953963 11:16168563-16168585 ATGGAAACCACTATATTTCTGGG + Intronic
1079411724 11:20193887-20193909 ATTGCCAACAATATTTATGTGGG + Intergenic
1079728206 11:23904088-23904110 TTTAAAAACACTATTTATTTTGG - Intergenic
1081125666 11:39317855-39317877 ATTGAAGTCACTATTATTGTTGG - Intergenic
1082302828 11:50530959-50530981 TTTGCAACCACTGTTTTTGTAGG - Intergenic
1082577672 11:54829507-54829529 TTTGGAAACACTATTTTTGTAGG + Intergenic
1082582516 11:54890288-54890310 TTTGAAAACACCATTTTTGTAGG + Intergenic
1086028207 11:82320471-82320493 ATTGAAAGCACTATTGAAATAGG - Intergenic
1087643014 11:100775583-100775605 TTTGAAAACACTGTTTATGGTGG + Intronic
1089121514 11:116138861-116138883 ATTTATACCAATAATTATGTCGG - Intergenic
1092189554 12:6508710-6508732 TTTGCAACCAGTATTTTTGTGGG - Intronic
1093523163 12:20073676-20073698 CTTGAAACCACTTGCTATGTGGG - Intergenic
1093534621 12:20209021-20209043 ATTGCAACCAATGTTTTTGTTGG + Intergenic
1094812931 12:34159234-34159256 ATTGAAAACACAATTCATGGAGG + Intergenic
1094827614 12:34283900-34283922 TTTGAAAACACTCTTTTTGTAGG - Intergenic
1094859637 12:34447924-34447946 TTTGAAAACACTGTTTTTGTAGG - Intergenic
1097042129 12:56162058-56162080 AGTGAAACCACTACTTCTGAAGG + Intronic
1098349476 12:69542814-69542836 ATTGAAACAACTGTTTATATTGG - Intronic
1098531937 12:71551678-71551700 ATTATAGCCACTGTTTATGTTGG + Intronic
1099616677 12:84944017-84944039 AATAACACCACTATGTATGTAGG + Intergenic
1100195716 12:92242056-92242078 ATTGAATGCTCTATTTGTGTAGG - Intergenic
1101436334 12:104667951-104667973 ATTGAAACCACTAATTCTAAAGG + Intronic
1103053399 12:117800273-117800295 ATTGAGCCCACTATACATGTTGG + Intronic
1105317615 13:19281305-19281327 ATTGAATCTATTAATTATGTTGG - Intergenic
1109355748 13:61229008-61229030 ATTGTTACCAATATTTAAGTGGG - Intergenic
1111422884 13:88039614-88039636 ATTTATACCTCTATTTATTTAGG + Intergenic
1111523592 13:89437458-89437480 ATGGAAATCAATATTTTTGTTGG - Intergenic
1112695669 13:101945316-101945338 ATTGTAACCATTATTTTTTTGGG - Intronic
1113169177 13:107479936-107479958 ATTGCAACCACTTTTCATGAAGG - Intronic
1113221582 13:108110033-108110055 ATTGATATCACAATTGATGTTGG - Intergenic
1113393834 13:109924507-109924529 TTTGAAAACAGTAATTATGTGGG + Intergenic
1114000487 14:18236571-18236593 ATTGGAAACACTGTTTTTGTGGG - Intergenic
1114822479 14:26038351-26038373 AGAGAAACCAATATTAATGTTGG - Intergenic
1115029441 14:28776821-28776843 ATAGACAACACTATTGATGTAGG - Intronic
1115433003 14:33342850-33342872 ATTAAAATCACTATCTCTGTGGG - Intronic
1116144400 14:41045243-41045265 ATTTAAAACATAATTTATGTCGG + Intergenic
1117069413 14:52043236-52043258 CATGAAACCACTATTTTTGTGGG + Intronic
1117272406 14:54158396-54158418 ATGGAACCCACTATTTTTCTTGG + Intergenic
1117554171 14:56867786-56867808 GCTGGAACCACTTTTTATGTTGG + Intergenic
1119904505 14:78289343-78289365 ATTTAAACCACCATTTTTATAGG + Intronic
1119931740 14:78554135-78554157 ATTGAAACTGCTAATTTTGTTGG + Intronic
1120474967 14:84975333-84975355 ATTGAAACCAACATTAATTTGGG - Intergenic
1122011937 14:98757545-98757567 ATTCTAATCACTATTTATCTAGG + Intergenic
1124068971 15:26373464-26373486 ATGGAAACCAGTTTTTCTGTAGG - Intergenic
1124585853 15:31005854-31005876 ATGGAAACCACTCTTTGTGTGGG - Intronic
1126307479 15:47276935-47276957 ATTGAAACATCTGTTGATGTCGG - Intronic
1130023908 15:80253933-80253955 ATTTAAACATCTATTTATCTGGG - Intergenic
1135106615 16:19655341-19655363 ATTGAATGCATTATTTATTTTGG - Intronic
1136744580 16:32574110-32574132 ATTGGAAATACTATTTTTGTAGG + Intergenic
1137045494 16:35654572-35654594 GTTGAAAACACTCTTTTTGTAGG + Intergenic
1137060148 16:35786151-35786173 GTTGGAAACACTATTTCTGTAGG - Intergenic
1137075106 16:35952285-35952307 GTTGAAAACACTATTTTTGTGGG - Intergenic
1138726693 16:59148018-59148040 ATTGTAACAACTATTTAATTCGG - Intergenic
1140562824 16:76003497-76003519 ATGATAACCACTACTTATGTGGG - Intergenic
1203025017 16_KI270728v1_random:501120-501142 ATTGGAAATACTATTTTTGTAGG - Intergenic
1203046704 16_KI270728v1_random:833311-833333 ATTGGAAATACTATTTTTGTAGG + Intergenic
1149114718 17:53079237-53079259 ATGCAAACCATTATTTTTGTTGG - Intergenic
1149618821 17:58025424-58025446 ATTGAAAGCACCATATATATGGG - Intergenic
1151712720 17:75815974-75815996 ATTGAAATAACCTTTTATGTTGG - Intronic
1155104372 18:22647030-22647052 ACTGAAACCAACATGTATGTTGG - Intergenic
1155112060 18:22725607-22725629 AATGAAACCATAATTTAAGTAGG - Intergenic
1155871049 18:31028704-31028726 ATTGAAACCATTACTGAAGTAGG - Intronic
1156342015 18:36218267-36218289 ATTAAAACCACCAGTTAGGTGGG - Intronic
1158998149 18:62944775-62944797 AATGAAAACACTATTTAAATGGG - Intronic
1159306430 18:66649195-66649217 ATTTAAACCTCTTTTTATGTAGG - Intergenic
1159342727 18:67157752-67157774 ATTGAAATAACTATTTTTCTTGG - Intergenic
1160218021 18:76950795-76950817 ATAGGAATCACTATCTATGTCGG + Intronic
1162871511 19:13590158-13590180 AATGCAACCCCTACTTATGTTGG - Intronic
1164334469 19:24299222-24299244 TTTGCAAACACTATTTTTGTAGG + Intergenic
1164373757 19:27666787-27666809 ATTGGAAACACTTTTTTTGTAGG - Intergenic
925974275 2:9130323-9130345 TTTCAAACCACTACTTCTGTGGG + Intergenic
925976322 2:9144569-9144591 ATTGAATACACAATTTACGTGGG + Intergenic
926444878 2:12929815-12929837 ATTAACACCAGTATTTAAGTGGG - Intergenic
926480276 2:13384147-13384169 ATGGAAATTACTATTTCTGTGGG + Intergenic
926879027 2:17520279-17520301 ATTGAAACCACTATTTATGTGGG + Intergenic
928963354 2:36952673-36952695 AATGAAACTATTATTAATGTTGG + Intronic
930040874 2:47122049-47122071 ATTGAAAGCTCTCTGTATGTGGG - Intronic
930548655 2:52802820-52802842 ATTGAAACCACATTTTGGGTGGG + Intergenic
930606734 2:53500681-53500703 ATTAAAACTACTATTTACTTTGG + Intergenic
933434415 2:82228212-82228234 ACTGAAACCACTATTTTCCTAGG - Intergenic
933480043 2:82845067-82845089 ATTAAAATTACAATTTATGTGGG - Intergenic
936341487 2:111637393-111637415 ATTCAATCCAGTATCTATGTGGG + Intergenic
937731464 2:125236127-125236149 ATTTAAACAACTAGTTATTTGGG - Intergenic
939094084 2:137813010-137813032 ATTGCAACAACTATATATTTAGG - Intergenic
939237599 2:139517470-139517492 ATTTAAACCACTATTATTTTTGG - Intergenic
940173800 2:150856667-150856689 ATTGAATCCAACATTTATGATGG + Intergenic
940934758 2:159478943-159478965 ATTCAAACCACTATTAATTTGGG - Intronic
941772564 2:169361052-169361074 AATGAAACCCCTATTGTTGTAGG - Intronic
942952665 2:181738585-181738607 ATTGAAATTACAATTTTTGTAGG - Intergenic
943038614 2:182776288-182776310 ATTGAAACCCATATTTGTGTTGG + Intronic
943895572 2:193354327-193354349 ATTTAAGCAAATATTTATGTAGG + Intergenic
947291532 2:228580967-228580989 ACTGAAACCAGTTTTTATCTTGG - Intergenic
1169470363 20:5879795-5879817 TATGAAACCGCTATTTTTGTTGG + Intergenic
1171161559 20:22929234-22929256 ATTGAAGCCATTATTTTTGGTGG - Intergenic
1172517724 20:35546915-35546937 ATTGAAATCACCAGTTATGATGG + Intronic
1174427799 20:50445251-50445273 ATTAAAACCACTATTTACATTGG + Intergenic
1174996320 20:55572894-55572916 TTTGAGACCACTATTCCTGTGGG + Intergenic
1176758844 21:10752577-10752599 TTTGGAAACACTCTTTATGTAGG + Intergenic
1177013151 21:15752609-15752631 ATGGAAACCATCATTTATCTAGG + Intronic
1180425001 22:15167369-15167391 ATTGGAAACACTGTTTTTGTGGG - Intergenic
1181905606 22:26193104-26193126 CTTGAAACCTCTTTTTATATAGG - Intronic
950319932 3:12042012-12042034 TTGGAAACTACTATATATGTTGG - Intronic
951157909 3:19377158-19377180 TTTGAAAACAATATTTTTGTTGG - Intronic
953667435 3:44935573-44935595 CTTGAAGCCACTAGCTATGTGGG + Intronic
955834476 3:63039721-63039743 ATTGAAACTTCTGTTTATGAAGG + Intergenic
956972881 3:74547388-74547410 ATTGACACCTTTATTTATATGGG + Intergenic
957594012 3:82237130-82237152 ATTTAAACCACTATTTATTCAGG + Intergenic
958213737 3:90531056-90531078 TTTGGAAACACTATTTTTGTAGG - Intergenic
958220410 3:90666116-90666138 ATTGGAAACACTATTTTTGTAGG - Intergenic
958572416 3:95904383-95904405 AGTATAACAACTATTTATGTAGG + Intergenic
959108393 3:102092639-102092661 ATTGATGCAACTATTTAAGTGGG - Intergenic
960231806 3:115237115-115237137 CTGGAAACCACTATTTAACTAGG + Intergenic
960409565 3:117306201-117306223 ATTGAGACCACTGATTATGCAGG + Intergenic
960765053 3:121117952-121117974 ATAGAAACAGCTATTTCTGTAGG + Intronic
961676240 3:128568722-128568744 ATTTATACCATTGTTTATGTGGG - Intergenic
961742739 3:129043856-129043878 AATGAATTCACTATTTTTGTTGG + Intergenic
962423350 3:135247895-135247917 AGTGAACCCACTATTTATAAAGG - Intronic
962736876 3:138333302-138333324 ATTAAAACCAGTATTACTGTTGG + Intergenic
963428042 3:145157114-145157136 ATTGAACCCACTTGTTGTGTGGG + Intergenic
963693835 3:148539832-148539854 ATGAAAATCAATATTTATGTAGG + Intergenic
963994395 3:151690822-151690844 CTTGAAGCCACTAGCTATGTGGG + Intergenic
964666452 3:159179475-159179497 ATGGTAACTACTACTTATGTTGG - Intronic
964832765 3:160903904-160903926 ATTGATACCTATATTTATCTTGG + Intronic
966483065 3:180433128-180433150 GTTTAAACCACTGTTAATGTGGG - Intergenic
967532916 3:190569808-190569830 AAGGAAACCAGTATTTTTGTAGG + Intronic
968323729 3:197793727-197793749 ATAGAAACCACATTTTTTGTTGG + Intronic
970799285 4:19952499-19952521 ATTCCCACCACTATTTCTGTGGG - Intergenic
971592497 4:28485763-28485785 CTTGAAACAGCTCTTTATGTTGG - Intergenic
972367424 4:38389662-38389684 ATGGAAAGCACTATTTGTGGAGG + Intergenic
972995623 4:44875523-44875545 ATTGAAAACAAGATTTATATTGG - Intergenic
973093061 4:46162621-46162643 ATTAAAGCCACTTTTTATTTTGG + Intergenic
973653321 4:53019332-53019354 ATTTAAAGCCCTGTTTATGTAGG + Intronic
974295285 4:59990626-59990648 ATGGGAACCAATATTAATGTAGG - Intergenic
975506705 4:75146043-75146065 ATTGAAACAGCTATGTATCTGGG - Intergenic
976327528 4:83789457-83789479 AATGACAGTACTATTTATGTAGG - Intergenic
977023318 4:91784875-91784897 ATGGAAACCATAATTTTTGTTGG - Intergenic
978317104 4:107450396-107450418 TTTGAAACCACTTACTATGTGGG + Intergenic
980620516 4:135295769-135295791 ATTAAAAGCACTAGTAATGTTGG + Intergenic
980807681 4:137834608-137834630 ATTGAAACCACTGTATCTCTTGG + Intergenic
987508446 5:18802335-18802357 ATTGGAACAACAATTTATTTAGG - Intergenic
987656401 5:20813836-20813858 ATTGATATCATTATTTATCTTGG - Intergenic
988230956 5:28478968-28478990 ACTGAAACCACTATTTAAGAAGG + Intergenic
988704077 5:33706511-33706533 ATTGCAACCCCTCTTTATTTTGG + Intronic
988824282 5:34918869-34918891 ATTCAAAGCACTTTTTAAGTTGG + Intronic
990189561 5:53243711-53243733 AATGCATCCACTATTTTTGTGGG + Intergenic
990393472 5:55352715-55352737 ACCTAAACCACTATTTTTGTTGG + Intronic
990768047 5:59209600-59209622 ATTGGAACTATTATTTATTTTGG - Intronic
990806772 5:59671861-59671883 ATTAAAAGCACTACTTATGATGG + Intronic
991140009 5:63229522-63229544 ACTGAAACTACTAATTATATGGG - Intergenic
992410692 5:76502566-76502588 AATGACAGCACTATTTAGGTTGG - Intronic
993928853 5:93911236-93911258 TTTGAAACCACTAAATTTGTAGG + Intronic
994569706 5:101500438-101500460 ATGGAAGACACTTTTTATGTAGG - Intergenic
995554704 5:113315487-113315509 ATTCAAACGACTTTCTATGTTGG - Intronic
996195164 5:120596429-120596451 ATTGAAACTTCTATGTATTTGGG + Intronic
996373080 5:122774007-122774029 TTTCAAACCACTTTTAATGTGGG + Intergenic
1001367962 5:171163129-171163151 TTTAAAACCATAATTTATGTTGG - Intronic
1002116633 5:176966695-176966717 ATTGAAACCAATCTTCATCTTGG - Intronic
1004804344 6:19186066-19186088 ATTGAGACTACTATATATTTGGG - Intergenic
1006997641 6:38276836-38276858 ACTGAAACTACTATTTATAGTGG + Intronic
1007840695 6:44713640-44713662 AATCATACCACTATGTATGTGGG - Intergenic
1007939589 6:45767267-45767289 ATTGAAAGCAAAAATTATGTTGG + Intergenic
1009524525 6:64727946-64727968 ATTGAAACCACTACTGAAGCAGG + Intronic
1010077619 6:71818735-71818757 ATTGAAAGCACAATTTGAGTAGG - Intergenic
1010593797 6:77740837-77740859 ATTCAGACCACCAATTATGTAGG + Intronic
1012472073 6:99583361-99583383 AGTGATACCACTTTTTATCTAGG + Intergenic
1012568093 6:100685408-100685430 TTTTAAATCACTATTTATGTAGG - Intronic
1012844231 6:104369100-104369122 ATTAAAAACATTATTTAAGTAGG + Intergenic
1016626561 6:146176709-146176731 ATTGAATCAACTAATTATTTTGG - Intronic
1017253470 6:152307117-152307139 TTTGAAACCACTGTTTATGTAGG - Intronic
1017692525 6:156981019-156981041 AGTGAAGCCACTGTTTTTGTTGG + Intronic
1018224759 6:161617700-161617722 ATTCAAACCTCCACTTATGTTGG - Intronic
1018233392 6:161698368-161698390 ATTGAAACAAATATTTATTCAGG + Intronic
1018878845 6:167854087-167854109 TTTGAAACCAGTCTTTTTGTGGG - Intronic
1021382884 7:19989557-19989579 ATTAAAATCATCATTTATGTTGG - Intergenic
1022731775 7:33033103-33033125 ATTCAAACTAATTTTTATGTGGG - Intronic
1024886426 7:54147626-54147648 CTTGGAACCACATTTTATGTTGG + Intergenic
1025574804 7:62623011-62623033 ATTGGAACCACTGTTTTTCTGGG - Intergenic
1025940180 7:66070930-66070952 ATTGAAATTACCATTTATGAAGG - Intergenic
1027737381 7:81951046-81951068 ATTTGAACCATTGTTTATGTTGG + Intronic
1027737949 7:81959041-81959063 TTTGAAAGCACAATTTCTGTGGG + Intronic
1030021020 7:105275346-105275368 ATTGAAACAACTAATCATCTGGG + Intronic
1031108521 7:117576347-117576369 AGTATAACAACTATTTATGTAGG + Intronic
1031213861 7:118865407-118865429 ATTTAAAGCAATATTTATTTAGG + Intergenic
1031696347 7:124860374-124860396 ATTGTGTACACTATTTATGTAGG - Intronic
1031794194 7:126150745-126150767 ATTGATACCTCTACTTATCTTGG + Intergenic
1032292100 7:130597777-130597799 ATTGAACCCAATATTGATGCTGG + Intronic
1033454226 7:141487970-141487992 ATTAAAACCACCAATTATGGTGG - Intergenic
1035442419 7:158912944-158912966 ATTGAAACCAATGTTAATTTTGG + Intronic
1037061706 8:14519926-14519948 ATTTAAACCATGGTTTATGTTGG - Intronic
1037087794 8:14874506-14874528 ATTTAAGCCAATATTTATGTGGG - Intronic
1038784426 8:30598337-30598359 ATTGCTGCCACTATTTAAGTAGG - Intronic
1038814746 8:30890213-30890235 ATTTAAACATCTATTTATATAGG + Intronic
1039691052 8:39865161-39865183 CTTGAAACCACTTCTTATGTGGG - Intergenic
1040117549 8:43640955-43640977 GTTGAAAACACTCTTTTTGTAGG + Intergenic
1040123942 8:43714741-43714763 GTTGGAAACACTATTTTTGTAGG + Intergenic
1040126549 8:43744249-43744271 GTTGAAAACACTCTTTTTGTAGG + Intergenic
1040135251 8:43845877-43845899 ATTGGAAACACTCTTTTTGTAGG + Intergenic
1040297221 8:46160092-46160114 ATTGGAACCACTGATTTTGTAGG - Intergenic
1040320805 8:46298882-46298904 GTTGAAAACACTCTTTTTGTAGG - Intergenic
1040321411 8:46308672-46308694 TTTGAAAACACTCTTTTTGTAGG - Intergenic
1040343754 8:46464461-46464483 GTTGAAAACACTTTTTGTGTAGG - Intergenic
1040344419 8:46474772-46474794 ATTGGAAACACTGTTTTTGTAGG - Intergenic
1040344466 8:46475636-46475658 ATTGGAAACACTGTTTTTGTAGG - Intergenic
1040346773 8:46509702-46509724 GTTGAAATCACTGTTTTTGTAGG - Intergenic
1040347448 8:46520146-46520168 TTTGAAAACACTGTTTTTGTAGG + Intergenic
1040727264 8:50397322-50397344 TTTGAGACCAATAATTATGTAGG + Intronic
1041600635 8:59713224-59713246 ATTGAAACCTTTATTTCTGATGG - Intergenic
1044570698 8:93714887-93714909 ATTGATACCACTCTTAATTTGGG + Intronic
1045131220 8:99155587-99155609 TTTAAAACCACCATTTATTTAGG - Intronic
1045493702 8:102690227-102690249 ATTTAAACCACTATATTTTTAGG - Intergenic
1046238020 8:111452488-111452510 AATGAATCCACAATTTAAGTAGG - Intergenic
1046619242 8:116510597-116510619 ATTTAAAGAAATATTTATGTGGG - Intergenic
1046899927 8:119512947-119512969 GTTAAAACCACTCTTCATGTCGG + Intergenic
1050234732 9:3565932-3565954 CTTGAGCCCACTACTTATGTGGG - Intergenic
1051749562 9:20326999-20327021 ATTGAAAACACCATTCTTGTAGG - Intergenic
1052139052 9:24955083-24955105 ATTAAAACCACTGTTTCAGTAGG + Intergenic
1052491296 9:29172304-29172326 AATGAGACCACTATTTGGGTAGG - Intergenic
1053986466 9:43999465-43999487 TTTGGAAACACTATTTTTGTAGG + Intergenic
1057507164 9:95644498-95644520 ATTAATAACACAATTTATGTTGG - Intergenic
1058047484 9:100372229-100372251 ATTGAAACCTCCATTTAAGGAGG + Intergenic
1058560423 9:106223114-106223136 ATTAAAACCACTATTATTTTGGG + Intergenic
1059113604 9:111580260-111580282 TTTGAACACACTATTTATGAGGG - Intronic
1060208291 9:121695337-121695359 ATTGCAACCAATACTGATGTTGG - Intronic
1060609004 9:124943917-124943939 AATGAAATCACTATTTATACTGG + Intronic
1060695377 9:125705150-125705172 ATTGAAACCAAAAGTTATATAGG - Intronic
1203406648 Un_KI270538v1:26070-26092 ATTTGAAACACTATTTTTGTGGG + Intergenic
1185815129 X:3147655-3147677 TTTGAAGCCACTATTTCTGGTGG - Intergenic
1187409404 X:19036328-19036350 ATTAAAATCAGTATTAATGTTGG - Intronic
1187425041 X:19170081-19170103 ATTGACACGTCTATTTTTGTAGG - Intergenic
1188547128 X:31320336-31320358 ATAGAAACCTCTTGTTATGTGGG + Intronic
1189577880 X:42375036-42375058 ATTGCAACCAATACTGATGTTGG + Intergenic
1189767620 X:44388249-44388271 CTTGAAACTACAATTTATGTTGG + Intergenic
1191260830 X:58318730-58318752 ATTGAAAACATTCTTTTTGTAGG + Intergenic
1191319096 X:59173700-59173722 ATTGGAATCACTCTTTTTGTAGG + Intergenic
1191322173 X:59214836-59214858 ATTGGAATCACTCTTTTTGTAGG + Intergenic
1191351189 X:59603131-59603153 ATTGGAATCACTCTTTTTGTAGG + Intergenic
1191354398 X:59645990-59646012 ATTGGAATCACTCTTTTTGTAGG + Intergenic
1191356708 X:59676855-59676877 ATTGGAATCACTCTTTTTGTAGG + Intergenic
1191398015 X:60229179-60229201 ATTGGAATCACTCTTTTTGTAGG + Intergenic
1191467798 X:61163472-61163494 ATTGGAATCACTCTTTTTGTAGG + Intergenic
1191473452 X:61239404-61239426 ATTGGAATCACTCTTTTTGTAGG + Intergenic
1191481109 X:61341753-61341775 ATTGGAATCACTCTTTTTGTAGG + Intergenic
1191512707 X:61764652-61764674 ATTGGAATCACTCTTTTTGTAGG + Intergenic
1191520217 X:61864951-61864973 ATTGGAATCACTCTTTTTGTAGG + Intergenic
1191530217 X:61998852-61998874 ATTGGAATCACTCTTTTTGTAGG + Intergenic
1191548359 X:62241522-62241544 ATTGGAATCACTCTTTTTGTAGG + Intergenic
1191616921 X:63179347-63179369 ATTTAAACGATTATGTATGTTGG + Intergenic
1191619376 X:63199576-63199598 ATTTAAACGATTATGTATGTTGG - Intergenic
1193369881 X:80682294-80682316 ATCAAAAGTACTATTTATGTGGG - Intronic
1193911523 X:87312406-87312428 AGTGAAACTATTATTTATTTAGG + Intergenic
1194710326 X:97228389-97228411 TTTGAAAATACTATTTTTGTGGG + Intronic
1198194232 X:134343945-134343967 ATTGAAAGCACTCTTTTCGTAGG + Intergenic
1201266153 Y:12209065-12209087 TTTGAAGCCACTATTTCTGGTGG + Intergenic
1201647437 Y:16251049-16251071 ATTGAATCCACAAATTATTTTGG - Intergenic
1201655374 Y:16334252-16334274 ATTGAATCCACAAATTATTTTGG + Intergenic
1202023664 Y:20495673-20495695 TTTGAAACTATTATTTTTGTAGG + Intergenic