ID: 926883523

View in Genome Browser
Species Human (GRCh38)
Location 2:17575169-17575191
Sequence TCCTTCTGGATTGCAGGTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 126}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926883514_926883523 25 Left 926883514 2:17575121-17575143 CCCAGCCTATTAAACTTTTTGTA 0: 1
1: 0
2: 6
3: 68
4: 751
Right 926883523 2:17575169-17575191 TCCTTCTGGATTGCAGGTACTGG 0: 1
1: 0
2: 0
3: 8
4: 126
926883517_926883523 20 Left 926883517 2:17575126-17575148 CCTATTAAACTTTTTGTAGGAGA 0: 1
1: 0
2: 1
3: 18
4: 209
Right 926883523 2:17575169-17575191 TCCTTCTGGATTGCAGGTACTGG 0: 1
1: 0
2: 0
3: 8
4: 126
926883519_926883523 -6 Left 926883519 2:17575152-17575174 CCAAGAGCTGAACCTCTTCCTTC 0: 1
1: 0
2: 1
3: 11
4: 235
Right 926883523 2:17575169-17575191 TCCTTCTGGATTGCAGGTACTGG 0: 1
1: 0
2: 0
3: 8
4: 126
926883513_926883523 30 Left 926883513 2:17575116-17575138 CCATGCCCAGCCTATTAAACTTT 0: 1
1: 2
2: 56
3: 481
4: 2567
Right 926883523 2:17575169-17575191 TCCTTCTGGATTGCAGGTACTGG 0: 1
1: 0
2: 0
3: 8
4: 126
926883515_926883523 24 Left 926883515 2:17575122-17575144 CCAGCCTATTAAACTTTTTGTAG 0: 1
1: 0
2: 7
3: 44
4: 414
Right 926883523 2:17575169-17575191 TCCTTCTGGATTGCAGGTACTGG 0: 1
1: 0
2: 0
3: 8
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926883523 Original CRISPR TCCTTCTGGATTGCAGGTAC TGG Intronic
901938851 1:12646564-12646586 TCCATGTGGATTGCAGCCACTGG - Intronic
907576835 1:55534300-55534322 TCCTTCAGGGTGGCAGGAACAGG + Intergenic
907673385 1:56496606-56496628 TCCTTCCGGATAGCAGGGGCAGG + Exonic
913109490 1:115644605-115644627 TCCTTCTGAATCCCAGTTACAGG + Intronic
918623394 1:186630927-186630949 GATTTCTGGATCGCAGGTACAGG - Intergenic
918797923 1:188929149-188929171 TCCTTCTGGATTGAAGATTATGG + Intergenic
1064812651 10:19217911-19217933 AGCTTCTGGATACCAGGTACTGG - Intronic
1068649695 10:59508482-59508504 TCCCTCTGGGTTGCAGCCACAGG + Intergenic
1069855778 10:71440191-71440213 TCCTCCTGGGGTGCAGGGACTGG + Intronic
1074507015 10:114080010-114080032 TCCATCTGGAGTGCAGAAACAGG - Intergenic
1075076036 10:119350965-119350987 TCCGTCTGTGTTGCAGATACTGG + Intronic
1078386587 11:10898398-10898420 TCCTTCTGGAGTGGAGGGAATGG + Intergenic
1078543608 11:12230417-12230439 CCCTTCTGGAGTGGAGATACAGG + Intronic
1078836697 11:15036972-15036994 TCCTCCTGAATTGGAGGTAAAGG - Intronic
1078842394 11:15091138-15091160 TGGTGCTGGATTCCAGGTACAGG + Intergenic
1080226391 11:29965913-29965935 TGCTTTTGGCTTGCAGGTCCTGG - Intergenic
1085160584 11:74340072-74340094 TCCTTCTGTGCTGCAGGCACAGG - Intronic
1085175073 11:74478892-74478914 TCCTTCTGTATGTCAGGTACTGG + Intergenic
1085325616 11:75604337-75604359 TCCTTCTGGTTTGGAGGAAGTGG - Intronic
1086943608 11:92823126-92823148 TCCTGCTGCATGGCAGGCACTGG - Intronic
1089835374 11:121365785-121365807 TCCTACTGGATGGCAGGCATTGG - Intergenic
1090408318 11:126490865-126490887 TCCTTCTGGAGTGCAAGGTCAGG + Intronic
1092012365 12:5125182-5125204 TACTTCAGGATTGCAGTTAAGGG + Intergenic
1092596869 12:10016142-10016164 CCCTTTTGGATTGTAGGTGCTGG - Intronic
1093350783 12:18101222-18101244 TCCTTCTGTAGTGCAGCTGCTGG + Intronic
1095403477 12:41841530-41841552 TCCTTCTTGACTGGAGGTGCTGG - Intergenic
1101648056 12:106649783-106649805 TCCTTCTGCATTTCTGGTAGTGG + Intronic
1101702143 12:107184080-107184102 TCCTTCTGATATGCAGGAACAGG - Intergenic
1111626191 13:90790746-90790768 TCCTTCTAGACTTCAGCTACTGG - Intergenic
1113135008 13:107079558-107079580 TACTTCTGGGGTGCAGATACAGG + Intergenic
1113946729 13:114048644-114048666 TCCTTCGGGATTCCAGGCGCAGG - Intronic
1115726417 14:36222054-36222076 TCCTTCTTGATTGCAGGAATAGG + Intergenic
1120131994 14:80818727-80818749 TCCTTCTAGGTTGCAAGTAATGG - Intronic
1120937330 14:89910107-89910129 ATCTTCTGCATTGCAGATACTGG - Intronic
1126104838 15:45140879-45140901 CCCTTCTTGGTTCCAGGTACTGG + Exonic
1126340593 15:47636776-47636798 CCCTTCTGTATTGCAGGCCCTGG - Intronic
1131642366 15:94306262-94306284 TGCTTGTGGCTGGCAGGTACTGG - Intronic
1134038585 16:11050761-11050783 TCCTGCTGGACGGCAGGTGCTGG - Intronic
1139162346 16:64526406-64526428 TCCTTCTCATTTGTAGGTACAGG + Intergenic
1139357843 16:66377838-66377860 TCATTCTGAATTCCAGGAACAGG - Intronic
1139850815 16:69950877-69950899 TCCTTCTGGTGAGCAGGAACTGG - Intronic
1140372725 16:74421759-74421781 TCCTTCTGGTGAGCAGGAACTGG + Intronic
1142023467 16:87799280-87799302 TCATTCTTGATTGAAGGTAGAGG + Intergenic
1143283259 17:5770836-5770858 TCTCTCTGGAATGCAGGCACTGG + Intergenic
1143653607 17:8279820-8279842 TCCTTCTGCATTGCTCGTCCTGG + Intergenic
1143836854 17:9699765-9699787 TCCTTCTGCATTGCAGTTGGGGG + Intronic
1144779603 17:17801200-17801222 TCCATCTGGATAGGAGGTAGGGG - Intronic
1144831010 17:18131223-18131245 TCCTTCTGGAGTCCAGATCCTGG + Exonic
1147681758 17:42252979-42253001 TCTTTCTGGATTGTAGTTAGTGG - Intronic
1148538057 17:48457185-48457207 TCTTTCTGGGTTGCAGGTGCAGG + Intergenic
1154937062 18:21071584-21071606 TCCTGCTGCATGGCAGGAACTGG + Intronic
1156510609 18:37633607-37633629 TTCTTCAGGAATTCAGGTACTGG - Intergenic
1156656920 18:39299292-39299314 TCATTCTTGAGTGCAGGCACAGG + Intergenic
1157724149 18:49950787-49950809 TTGTTTTAGATTGCAGGTACTGG - Intronic
1158155074 18:54416695-54416717 TCCTTCTGCATTCCAGACACTGG + Intergenic
1164694755 19:30235001-30235023 TGCTTGTGGTTTCCAGGTACAGG + Intronic
1166342083 19:42144270-42144292 ACCTCCTGGGTTGCAGGTGCTGG - Intronic
1168586211 19:57594823-57594845 GCCTTCTGGAGGGCAGATACAGG + Intergenic
926272923 2:11380260-11380282 TCTTTCTGAATTGCTGTTACTGG - Intergenic
926883523 2:17575169-17575191 TCCTTCTGGATTGCAGGTACTGG + Intronic
931775474 2:65536762-65536784 CCCTTGTGTATTGCAGCTACAGG - Intergenic
932833604 2:75013511-75013533 ACCTTCTGAAATGCAAGTACAGG + Intergenic
935246878 2:101226465-101226487 CCCTCCTGGATGGCAGGGACAGG + Intronic
936670074 2:114646506-114646528 TTCCTCTGAATTGCAGGAACTGG - Intronic
938890524 2:135700357-135700379 TTCTTCTGAATTGAAGATACTGG - Intronic
942233313 2:173879861-173879883 TCTTTATGGATTGGAGGTAATGG - Intergenic
943728572 2:191277764-191277786 TCCTTCTCAGCTGCAGGTACAGG - Intronic
948871511 2:240801517-240801539 TCCTTCTAGATTCCACTTACAGG - Intronic
1173713512 20:45180976-45180998 CCCTTCTGGAATTCAGGAACAGG + Intergenic
1176717779 21:10368114-10368136 TCCTGCTTGATTCCAGGTCCTGG + Intergenic
1177587752 21:23120191-23120213 TCCTCCAGTGTTGCAGGTACTGG + Intergenic
1179966647 21:44810676-44810698 TCTGTCTGGATTGCAGGTTCTGG - Intronic
1180299006 22:11021020-11021042 TCCTGCTTGATTCCAGGTCCTGG + Intergenic
1181398691 22:22638457-22638479 TCCTTCTGCAGTGCAGGCAAAGG + Intergenic
1181994798 22:26868794-26868816 TTCTTCTGGATTGAGGGTATGGG + Intergenic
950693621 3:14680990-14681012 TCCTGCTGGTTTGCAGATAGTGG - Intronic
952321812 3:32284684-32284706 TCCTCCTGGCTTCCAGGTACTGG - Intronic
952721067 3:36533230-36533252 TCATTCTTGATTCCAGGCACAGG + Intronic
955117577 3:56020927-56020949 TCCTACTGGCATGCAGGTAGGGG + Intronic
956661970 3:71607993-71608015 TCATTATGGAATGCAGGGACAGG - Intergenic
956906800 3:73774315-73774337 TCCTACTGAGTTGCAGGCACTGG + Intergenic
957197025 3:77081914-77081936 TCCTTCTGAAGTGAAGGTATGGG - Intronic
958193161 3:90209255-90209277 TTCTTCTGGATGGGAGTTACAGG - Intergenic
958416461 3:93880198-93880220 TTCTTCTGGATGGGAGTTACAGG - Intronic
962326117 3:134433637-134433659 TGCTTCTGGTTTGTAGGTAATGG + Intergenic
969116526 4:4873778-4873800 TCCTCCTGGAATGAAGGTGCTGG - Intergenic
969934678 4:10668727-10668749 TCTTTCTGGGTTGCGGGTAGAGG + Intronic
971491647 4:27218643-27218665 TCATTCTAGGTTGCAGGTGCAGG + Intergenic
972355486 4:38276435-38276457 TCCATCTTGAATGCAGGTAACGG + Intergenic
973316676 4:48767823-48767845 TAATCCTGGATTGCAGCTACGGG + Intronic
973852672 4:54976843-54976865 TCCCTCTGGTGTGCAGGTGCTGG - Intergenic
982394998 4:154906902-154906924 TCCTTTTGCATTGCAGGGGCCGG + Intergenic
984396864 4:179212891-179212913 TCCTCCTGGATTTCAGTAACTGG + Intergenic
985918261 5:2944849-2944871 TCCTTCTGGATTCTAATTACAGG + Intergenic
988714855 5:33815446-33815468 TCTTTCTGGCTTGCAGGCACTGG - Intronic
991735459 5:69627775-69627797 TACCTCTGGATTGGAGGGACAGG - Intergenic
991779460 5:70118405-70118427 TACCTCTGGATTGGAGGGACAGG + Intergenic
991811947 5:70483414-70483436 TACCTCTGGATTGGAGGGACAGG - Intergenic
991858752 5:70993878-70993900 TACCTCTGGATTGGAGGGACAGG + Intronic
991871912 5:71118762-71118784 TACCTCTGGATTGGAGGGACAGG + Intergenic
992483052 5:77170014-77170036 TCCTTTTTGCTTGCAGGTGCAGG - Intergenic
997477662 5:134154951-134154973 TCCTTGTGAAATGCAGGTACAGG - Exonic
998213556 5:140219984-140220006 TCCTCCTGGTTTTCAGGCACTGG - Intronic
998623941 5:143824266-143824288 TCCTTCTCTATTGCAGCCACCGG - Intergenic
998885594 5:146690805-146690827 ACCTTCTGTACTGAAGGTACAGG - Intronic
999465245 5:151797303-151797325 TCCTCTTGGATTTCAGATACAGG - Exonic
1003168359 6:3700884-3700906 TCCTTCTGGATGCTAGGGACAGG + Intergenic
1005970033 6:30753502-30753524 TAATTCTGGATGGCAGGTTCAGG - Intergenic
1008376983 6:50802896-50802918 CCCTTCTGGCTTGCAGATAAAGG + Intergenic
1013090669 6:106897739-106897761 TTCTCCTGGATTGTAGGTGCGGG - Intergenic
1018427904 6:163699965-163699987 TCCTTCTGGATGGGAGCAACTGG + Intergenic
1019173941 6:170150297-170150319 TCTGTCTGCATTGCAGGTAGTGG - Intergenic
1021454361 7:20813369-20813391 TCCTTGTGAATTCCAGATACTGG + Intergenic
1029013802 7:97292833-97292855 ATTTTCTGGATTGCAGTTACAGG + Intergenic
1032443334 7:131959174-131959196 TCCTTCTGGGCTTCAGGCACAGG - Intergenic
1035430973 7:158821603-158821625 TCCTTCTGGATGGCTGGCCCAGG - Intronic
1037630459 8:20651070-20651092 TCCGTCTGGATTCCTGGGACTGG - Intergenic
1038470638 8:27815352-27815374 TCCTTCTTGCCTGCTGGTACTGG - Intronic
1043918910 8:85958565-85958587 TCATCCAGGATTACAGGTACTGG + Intergenic
1045053079 8:98344334-98344356 TTCTTTTGCATTGCAGATACAGG - Intergenic
1051150961 9:14078748-14078770 ACCTTGTGGGGTGCAGGTACAGG + Intergenic
1052611511 9:30781120-30781142 TCCTTCTGTACTGCAGGAATGGG + Intergenic
1052865963 9:33464816-33464838 TCTTTATGGATTGCAGGCAAGGG - Intronic
1057963202 9:99477234-99477256 TTCTTCTGGTTTTCAGGCACTGG + Intergenic
1061861285 9:133469855-133469877 AGCTTCTGGAGCGCAGGTACTGG + Exonic
1062462481 9:136667706-136667728 TCCTGCTGGCTTGCAGCTGCTGG + Intronic
1185542694 X:916083-916105 TCCTGCTTGATTCCAGGTTCTGG - Intergenic
1185622064 X:1456081-1456103 TCCTTCTGGAATGCTGGTATGGG - Intergenic
1186642489 X:11470963-11470985 TCCTTCTTGTTTGCATATACAGG + Intronic
1191146943 X:57177068-57177090 TCCTTGTGGATTGCTCCTACTGG - Intergenic
1192366446 X:70477655-70477677 TCCTCCAGGATTTCAGGAACAGG + Intronic
1195118222 X:101721650-101721672 TCCCTGTGAACTGCAGGTACTGG - Intergenic
1198512597 X:137368434-137368456 TCCTTCTAGGTTGCAGGTTTAGG - Intergenic
1200210211 X:154343752-154343774 TTCGACTGGATTGCAGGTCCGGG - Intergenic
1200220641 X:154388340-154388362 TTCGACTGGATTGCAGGTCCGGG + Intergenic