ID: 926883525

View in Genome Browser
Species Human (GRCh38)
Location 2:17575170-17575192
Sequence CCTTCTGGATTGCAGGTACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 156}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926883515_926883525 25 Left 926883515 2:17575122-17575144 CCAGCCTATTAAACTTTTTGTAG 0: 1
1: 0
2: 7
3: 44
4: 414
Right 926883525 2:17575170-17575192 CCTTCTGGATTGCAGGTACTGGG 0: 1
1: 0
2: 0
3: 4
4: 156
926883519_926883525 -5 Left 926883519 2:17575152-17575174 CCAAGAGCTGAACCTCTTCCTTC 0: 1
1: 0
2: 1
3: 11
4: 235
Right 926883525 2:17575170-17575192 CCTTCTGGATTGCAGGTACTGGG 0: 1
1: 0
2: 0
3: 4
4: 156
926883514_926883525 26 Left 926883514 2:17575121-17575143 CCCAGCCTATTAAACTTTTTGTA 0: 1
1: 0
2: 6
3: 68
4: 751
Right 926883525 2:17575170-17575192 CCTTCTGGATTGCAGGTACTGGG 0: 1
1: 0
2: 0
3: 4
4: 156
926883517_926883525 21 Left 926883517 2:17575126-17575148 CCTATTAAACTTTTTGTAGGAGA 0: 1
1: 0
2: 1
3: 18
4: 209
Right 926883525 2:17575170-17575192 CCTTCTGGATTGCAGGTACTGGG 0: 1
1: 0
2: 0
3: 4
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926883525 Original CRISPR CCTTCTGGATTGCAGGTACT GGG Intronic
903062928 1:20682931-20682953 CCTGCTGGATGGCACGTGCTCGG - Intronic
905494485 1:38374001-38374023 CCATCTTGATTGAAGTTACTAGG - Intergenic
908165630 1:61454922-61454944 CGTTCTGTATTCCAGGCACTGGG + Intronic
908722104 1:67136624-67136646 CGTTCTGCATGTCAGGTACTAGG + Intronic
914981577 1:152419252-152419274 CCTTCCAGTTTGCAGGTTCTAGG - Intergenic
915010956 1:152685968-152685990 CTCTTTGGATTGCAGGGACTAGG + Intergenic
918303622 1:183226683-183226705 TTCTCTCGATTGCAGGTACTGGG + Exonic
918623393 1:186630926-186630948 ATTTCTGGATCGCAGGTACAGGG - Intergenic
919749408 1:201027390-201027412 GCTTCTGGAGTACAGGGACTAGG - Intergenic
920275379 1:204800581-204800603 CCTTCTGGTTTTGTGGTACTGGG + Intergenic
922675058 1:227544646-227544668 CCTTCTGGCTGGCAGGATCTTGG + Intergenic
1063584044 10:7334878-7334900 ACTCCTGGATGGCAGGTTCTAGG - Intronic
1066198182 10:33122089-33122111 CTTTCTGGATTGTGGGCACTGGG + Intergenic
1067053482 10:43038399-43038421 CCTTGGGGAGTGCAGGTCCTTGG - Intergenic
1069031676 10:63602856-63602878 CCTACTGCATAGTAGGTACTGGG + Intronic
1069748178 10:70729224-70729246 CCTACTGCATGCCAGGTACTGGG - Intronic
1070725288 10:78783557-78783579 CCTACTGCATTCCAGGCACTGGG + Intergenic
1074946004 10:118281226-118281248 CATTCTGGATTCCAAGGACTTGG + Intergenic
1075076038 10:119350966-119350988 CCGTCTGTGTTGCAGATACTGGG + Intronic
1075588693 10:123676126-123676148 CCCTGTGGATTGCAGACACTGGG + Intronic
1076036525 10:127202692-127202714 CCTCCAGGGTGGCAGGTACTCGG + Intronic
1078543610 11:12230418-12230440 CCTTCTGGAGTGGAGATACAGGG + Intronic
1080266191 11:30404487-30404509 CCTTCAGGAATGAAGCTACTTGG + Intronic
1080784695 11:35463814-35463836 CCTTCTTGACAGCTGGTACTAGG + Intronic
1082859057 11:57836291-57836313 GCCTCTGGATGGCAGGAACTAGG - Intergenic
1083464890 11:62838918-62838940 CCTACTGAATTCCAGGCACTGGG - Intronic
1084216273 11:67648539-67648561 CCTGCTGGATGCCAGGTGCTGGG + Intronic
1085175075 11:74478893-74478915 CCTTCTGTATGTCAGGTACTGGG + Intergenic
1085493585 11:76946284-76946306 CCTCCTGGGTTGCAGGTCCAAGG - Intronic
1086570382 11:88277014-88277036 CCATCTGTATTTCAGGTTCTGGG - Intergenic
1086943606 11:92823125-92823147 CCTGCTGCATGGCAGGCACTGGG - Intronic
1089682501 11:120126822-120126844 CCAGCTGGATTGCAGTTGCTTGG + Intronic
1089835372 11:121365784-121365806 CCTACTGGATGGCAGGCATTGGG - Intergenic
1092934219 12:13345446-13345468 CCCTCAGGTTTGCAGGTACTAGG + Intergenic
1094807200 12:34105900-34105922 CCTTCTGGCTGGCAGGATCTTGG - Intergenic
1095403475 12:41841529-41841551 CCTTCTTGACTGGAGGTGCTGGG - Intergenic
1098560627 12:71867612-71867634 CTTTGTGGATTTCAGGTATTTGG - Intronic
1099115211 12:78615666-78615688 TCTTCTGGATCAGAGGTACTTGG - Intergenic
1099316963 12:81096057-81096079 CCATCTGAATTACAGATACTTGG - Intronic
1100341540 12:93684090-93684112 CCTACTGAATGCCAGGTACTGGG + Intronic
1101593979 12:106147475-106147497 CCTACTATATAGCAGGTACTAGG - Intergenic
1105828611 13:24144423-24144445 CCTTCTGTGTTCCAGGAACTAGG + Intronic
1112135305 13:96571884-96571906 CTTGCTGGATTTCAGGAACTCGG - Intronic
1112448414 13:99488215-99488237 CCTTCTGCAGTGAAAGTACTAGG - Intergenic
1113652571 13:112046217-112046239 CCTTCAGGATTATGGGTACTGGG - Intergenic
1113660367 13:112103442-112103464 ACTTCTGGATTTCAGGGGCTTGG - Intergenic
1115865136 14:37737383-37737405 CCTTGTACATAGCAGGTACTTGG + Intronic
1120937329 14:89910106-89910128 TCTTCTGCATTGCAGATACTGGG - Intronic
1121512205 14:94520851-94520873 CCCACTGGATTCCAGGTACAAGG - Intergenic
1129798703 15:78397298-78397320 CCTCCTGAATTCCAGGCACTTGG + Intergenic
1130338945 15:82982780-82982802 CCTTCTTGATTCCCGATACTAGG + Intronic
1131417128 15:92270029-92270051 TCAACTGGATTGCAGTTACTGGG - Intergenic
1131642365 15:94306261-94306283 GCTTGTGGCTGGCAGGTACTGGG - Intronic
1134390234 16:13813168-13813190 CCTCCAGGAATGCAGGAACTTGG + Intergenic
1134795705 16:17034727-17034749 CCTTCTTGATTGCCTGGACTGGG + Intergenic
1139850813 16:69950876-69950898 CCTTCTGGTGAGCAGGAACTGGG - Intronic
1140372727 16:74421760-74421782 CCTTCTGGTGAGCAGGAACTGGG + Intronic
1142623011 17:1176911-1176933 CCTACTGTATGGCAGGCACTGGG - Intronic
1142910597 17:3087411-3087433 TCTTGGGGATGGCAGGTACTAGG + Intergenic
1143280798 17:5752739-5752761 CCTTCAGGATCCCAGGCACTGGG - Intergenic
1146902508 17:36597907-36597929 CATTCTTGTTTGCAGGAACTTGG + Intronic
1148538058 17:48457186-48457208 CTTTCTGGGTTGCAGGTGCAGGG + Intergenic
1149026985 17:52038051-52038073 CCTTCTGTATACCAGGCACTTGG - Intronic
1152738221 17:82007784-82007806 CCCTCTGGAATGCAGGCGCTGGG + Intronic
1153919634 18:9776883-9776905 CATTCTGGATTTCAGGTTTTTGG - Intronic
1154173927 18:12069671-12069693 CCTTCTGGAGTTCAGCTATTTGG + Intergenic
1154431260 18:14310217-14310239 CCTTCTGGTTTGGAGTTTCTTGG + Intergenic
1156524537 18:37754352-37754374 CTTTCTGCATTCCAGGGACTTGG - Intergenic
1157724148 18:49950786-49950808 TGTTTTAGATTGCAGGTACTGGG - Intronic
1157895830 18:51466068-51466090 CCTCCTGGATGCCAGGTATTGGG + Intergenic
1158155076 18:54416696-54416718 CCTTCTGCATTCCAGACACTGGG + Intergenic
1158934663 18:62353751-62353773 TTTTCTGGAATGCAGGTACGTGG - Intronic
1166123868 19:40702214-40702236 CCTTCTGCACTGCAGGTTGTGGG - Intronic
1167350100 19:48969104-48969126 GATTCTGGAGTGCAGGAACTTGG + Exonic
1168586213 19:57594824-57594846 CCTTCTGGAGGGCAGATACAGGG + Intergenic
926883525 2:17575170-17575192 CCTTCTGGATTGCAGGTACTGGG + Intronic
927072159 2:19542122-19542144 CCTCCTGGGTTTCAGGTAGTAGG + Intergenic
928305048 2:30162628-30162650 CCTTCTGGTTTCAAGTTACTTGG - Intergenic
928438513 2:31272090-31272112 TCTTCAGGAATGTAGGTACTGGG + Intergenic
931464470 2:62474572-62474594 CCTACTGTATGGCAGCTACTGGG + Intergenic
932819203 2:74885293-74885315 CCTACTGTGTAGCAGGTACTGGG - Intronic
932903670 2:75727128-75727150 CATTTTGGATTTCAGGTATTTGG - Intergenic
934897837 2:98133936-98133958 TCTTTTGGATTCCAGGTACCTGG - Exonic
935246880 2:101226466-101226488 CCTCCTGGATGGCAGGGACAGGG + Intronic
936670073 2:114646505-114646527 TCCTCTGAATTGCAGGAACTGGG - Intronic
936750720 2:115638443-115638465 GCTTCTGGCTTACAGGCACTTGG - Intronic
937774131 2:125755686-125755708 CCTTATGGATTGCAAGCTCTTGG + Intergenic
939940207 2:148340191-148340213 CCTTCTGGCATGAAGGTATTGGG - Intronic
940418693 2:153453381-153453403 CCTTATGGATTCCAGATATTTGG - Intergenic
944677309 2:202044405-202044427 CCTTCTGGATTTGTGGTTCTGGG + Intergenic
948553073 2:238787731-238787753 CCTGCTGGATTTCAGGGACCTGG - Intergenic
1171989723 20:31686635-31686657 CCTTCTAGATTCCTGTTACTTGG + Intronic
1173340463 20:42148506-42148528 CCATCTGGATGCCAGGTGCTGGG + Intronic
1174559664 20:51421637-51421659 CCTCCTGCATGGCAGCTACTGGG - Intronic
1176717781 21:10368115-10368137 CCTGCTTGATTCCAGGTCCTGGG + Intergenic
1176890278 21:14308491-14308513 ACTTCTGGGTTGAAGGTAATTGG + Intergenic
1177587754 21:23120192-23120214 CCTCCAGTGTTGCAGGTACTGGG + Intergenic
1179211907 21:39331915-39331937 CCTTTTGGATTAAAGGTTCTAGG - Intergenic
1179548185 21:42126018-42126040 TCTTGTGGATTTCAGGGACTGGG - Intronic
1180299008 22:11021021-11021043 CCTGCTTGATTCCAGGTCCTGGG + Intergenic
1183784967 22:40023926-40023948 ATTTCAGGACTGCAGGTACTGGG - Intronic
1184976672 22:48067108-48067130 GCTTCTGGATTGAAGTTCCTTGG - Intergenic
949979129 3:9489222-9489244 CATTCTGGATTGAATTTACTAGG - Intergenic
954360679 3:50121202-50121224 CCTTCTGGTTTGGAAGCACTAGG + Intergenic
956738630 3:72258246-72258268 CCTCCTGAATGGCAGGTATTTGG + Intergenic
962258466 3:133887725-133887747 CCTTCTGGCTTGGAGATACCAGG - Intronic
963559259 3:146840681-146840703 GCTTTTGCATTGCAGTTACTTGG + Intergenic
963845261 3:150149141-150149163 CCTACTGTATTTCAGGTATTAGG + Intergenic
969468150 4:7369927-7369949 CCTTCTGGAAGGCAGGAAATAGG + Intronic
970526535 4:16938195-16938217 CCTTCTAGCCTGCAGGTAGTAGG - Intergenic
971595215 4:28518517-28518539 CCTTCTGCAAAGCAGATACTTGG - Intergenic
972299549 4:37772014-37772036 CCATATGGCTTGCTGGTACTAGG - Intergenic
978731184 4:112028541-112028563 CATTCTGGAATGCAGGTAGGAGG - Intergenic
984562257 4:181284388-181284410 CATTTTGGTTTGCAGGTTCTGGG + Intergenic
991329823 5:65482019-65482041 CCTTCTGAATGGCTGGTAGTTGG - Intergenic
991989738 5:72325793-72325815 CCTTCTGGAAAGCAGATGCTTGG + Intronic
996608824 5:125355704-125355726 CCTTCAAGATAGCAGATACTTGG + Intergenic
997477660 5:134154950-134154972 CCTTGTGAAATGCAGGTACAGGG - Exonic
998213554 5:140219983-140220005 CCTCCTGGTTTTCAGGCACTGGG - Intronic
998885592 5:146690804-146690826 CCTTCTGTACTGAAGGTACAGGG - Intronic
1000255273 5:159531966-159531988 GCTTCTGGATTGCTGTTGCTAGG + Intergenic
1001906757 5:175479113-175479135 CCTACTGGATTGCGAGTTCTAGG - Intronic
1002811809 6:638606-638628 CCTCCTGTATGCCAGGTACTGGG - Intronic
1006979529 6:38135865-38135887 CCTTCTGGACTGCAGGCTCAAGG - Intronic
1008481691 6:51992874-51992896 CCTTCAGTATTGCTGGTACAAGG + Intronic
1009538471 6:64922783-64922805 CCTTGTGACCTGCAGGTACTGGG - Intronic
1011740370 6:90353588-90353610 ACTTCCAGATTGCAGGTGCTGGG - Intergenic
1014831269 6:126105490-126105512 TCATCTGGCTTCCAGGTACTTGG - Intergenic
1015335150 6:132028478-132028500 ATTTCTGGATTGCAGATATTAGG - Intergenic
1018427906 6:163699966-163699988 CCTTCTGGATGGGAGCAACTGGG + Intergenic
1019071997 6:169354250-169354272 CCTTCTGCATTGATGTTACTGGG + Intergenic
1019647898 7:2140725-2140747 CTTTCTGGCATGCAGGGACTGGG - Intronic
1022855618 7:34310627-34310649 CATTGTGGATTGCAGGATCTGGG - Intergenic
1027266299 7:76496928-76496950 CCTCCTGGCTTGGAGTTACTAGG - Intronic
1027317679 7:76995046-76995068 CCTCCTGGCTTGGAGTTACTAGG - Intergenic
1027659641 7:80974108-80974130 CCTTCCTGATTGCATGGACTCGG - Intergenic
1028176319 7:87663828-87663850 CCTTCTGGCTTGTAGGTGGTTGG + Intronic
1030023040 7:105294111-105294133 CCTTCTGGTTGTCAGGAACTAGG - Intronic
1037083194 8:14813103-14813125 CCTGATGCATTGCAGATACTGGG + Intronic
1038470636 8:27815351-27815373 CCTTCTTGCCTGCTGGTACTGGG - Intronic
1039498430 8:37998587-37998609 CCTTGTGCAGTGCAGGCACTGGG + Intergenic
1041742782 8:61175012-61175034 GCTTCTGGCTTGCAAGTCCTAGG + Intronic
1043399393 8:79868894-79868916 CCCTCTGGATTGCTGGAAATCGG + Intergenic
1044604610 8:94037775-94037797 CCTTAGAGATTGCAGGGACTGGG + Intergenic
1048422681 8:134292852-134292874 CCTCCTGGAATGGAGGCACTTGG - Intergenic
1048971865 8:139649652-139649674 CCTGTTGTCTTGCAGGTACTGGG - Intronic
1049065085 8:140307042-140307064 CCATGTGGTTTGCAGGGACTCGG + Intronic
1052388674 9:27852475-27852497 CCTTCTGTCAGGCAGGTACTAGG + Intergenic
1056316780 9:85397886-85397908 AATTTTGGAGTGCAGGTACTAGG + Intergenic
1060534597 9:124374696-124374718 CCTCCTGTATTCCAGCTACTTGG + Intronic
1061606386 9:131714140-131714162 CCTCCTGGAGTCCAGCTACTCGG - Intronic
1061861286 9:133469856-133469878 GCTTCTGGAGCGCAGGTACTGGG + Exonic
1185542692 X:916082-916104 CCTGCTTGATTCCAGGTTCTGGG - Intergenic
1185622062 X:1456080-1456102 CCTTCTGGAATGCTGGTATGGGG - Intergenic
1187957376 X:24532897-24532919 CATTTTGGATTGCAGATTCTTGG - Intronic
1189674537 X:43447762-43447784 CGTTCTGTATGGTAGGTACTAGG + Intergenic
1189808322 X:44757348-44757370 TCTTCTGGACTAAAGGTACTTGG - Intergenic
1190969667 X:55336324-55336346 GCTTTTGGATTGCAGATATTTGG + Intergenic
1196822351 X:119712057-119712079 CTTTTTGGCTTGCAGGTTCTTGG + Intergenic
1197129098 X:122983475-122983497 CATTCTGGACTGCAGTAACTTGG + Intergenic
1201969647 Y:19777329-19777351 CCTTCTGGTTTGTAGGGATTTGG - Intergenic