ID: 926886351

View in Genome Browser
Species Human (GRCh38)
Location 2:17602271-17602293
Sequence GAGGGTTGTTATGAAGCTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 126}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926886348_926886351 -4 Left 926886348 2:17602252-17602274 CCATTGACTGTTTCTCTCTGAGG 0: 1
1: 0
2: 1
3: 22
4: 663
Right 926886351 2:17602271-17602293 GAGGGTTGTTATGAAGCTTGTGG 0: 1
1: 0
2: 0
3: 9
4: 126
926886347_926886351 2 Left 926886347 2:17602246-17602268 CCTGGGCCATTGACTGTTTCTCT 0: 1
1: 0
2: 2
3: 15
4: 218
Right 926886351 2:17602271-17602293 GAGGGTTGTTATGAAGCTTGTGG 0: 1
1: 0
2: 0
3: 9
4: 126
926886346_926886351 17 Left 926886346 2:17602231-17602253 CCAATTGGAAGGATTCCTGGGCC 0: 1
1: 0
2: 0
3: 13
4: 156
Right 926886351 2:17602271-17602293 GAGGGTTGTTATGAAGCTTGTGG 0: 1
1: 0
2: 0
3: 9
4: 126
926886342_926886351 30 Left 926886342 2:17602218-17602240 CCATCTTTGGTGTCCAATTGGAA 0: 1
1: 0
2: 0
3: 11
4: 109
Right 926886351 2:17602271-17602293 GAGGGTTGTTATGAAGCTTGTGG 0: 1
1: 0
2: 0
3: 9
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926886351 Original CRISPR GAGGGTTGTTATGAAGCTTG TGG Intronic
901685524 1:10941423-10941445 GAGGGCTGTGATGAAGCCGGGGG - Intergenic
902220896 1:14964297-14964319 TAGGATTGTTGTGAAGATTGAGG + Intronic
902411849 1:16216384-16216406 GAGGGCTGAGCTGAAGCTTGAGG + Intergenic
903383581 1:22912849-22912871 GGGGGTTGGTAGGAAGGTTGAGG + Intronic
904729572 1:32579004-32579026 GAGGCTTGTTTTTAAGCTTTGGG + Intronic
905327968 1:37171364-37171386 GAGAGTTGATATGAGGCTTAAGG - Intergenic
905356639 1:37389461-37389483 GAGGGTTGTTATGAGGATTAAGG - Intergenic
905685233 1:39902605-39902627 CAGGGTTGTTGTGAGGCTTCAGG + Intergenic
907384967 1:54120410-54120432 GATGGTTGTGATGATGCGTGTGG - Intergenic
907433999 1:54432253-54432275 GAGGGCTATGATGTAGCTTGTGG - Intergenic
908513916 1:64873161-64873183 GAGGCTGGTTATCCAGCTTGTGG - Intronic
913326730 1:117634378-117634400 GAGGGTTGTTCTGAATCCAGAGG + Intergenic
915253699 1:154609052-154609074 GAGGGCTGTTGTGAAGATTAAGG - Intronic
918179186 1:182071097-182071119 TAAGGCTGTTCTGAAGCTTGGGG - Intergenic
918820623 1:189250002-189250024 GAGGGATGGCCTGAAGCTTGGGG + Intergenic
923682558 1:236129878-236129900 TACGGTTGTTTTCAAGCTTGAGG - Intergenic
1063134108 10:3201570-3201592 GTGGGGTGTAATGAGGCTTGAGG + Intergenic
1065246465 10:23763708-23763730 CAGGTTTGTTATGAACCTTTTGG - Intronic
1066320849 10:34302373-34302395 CAGGGTTGTTTTGAAGCTAATGG - Intronic
1067010154 10:42703689-42703711 GAGGGGTGTTCTATAGCTTGAGG - Intergenic
1067313606 10:45139947-45139969 GAGGGGTGTTCTATAGCTTGAGG + Intergenic
1072630750 10:97144883-97144905 GGGGGATATTATGAAGATTGGGG - Intronic
1073715092 10:106096340-106096362 TAAGCTTGTTATGAGGCTTGTGG + Intergenic
1075991386 10:126841778-126841800 GAGGGTGCTTATGAAGCCTGTGG + Intergenic
1080271797 11:30458383-30458405 GAGGGTTGATGTGAAACTTAGGG - Intronic
1085310233 11:75511934-75511956 CAGGGCTGTTGTGAAGATTGAGG + Intronic
1087066207 11:94030254-94030276 GAGGCTTATTAGCAAGCTTGGGG + Intronic
1087822488 11:102728227-102728249 CTGGGTTGTTATGAAGCTTAAGG - Intergenic
1088234631 11:107709389-107709411 AAGGGTTGTTAGCAAGCTTTTGG + Intronic
1089970028 11:122685880-122685902 TAGGGCTGCTATGAAGCTCGAGG - Intronic
1090164718 11:124535043-124535065 GTGGGGTGGTATGAAGATTGAGG - Intergenic
1095550536 12:43433019-43433041 GAGGTTTTTGAGGAAGCTTGGGG - Intronic
1095973009 12:47917504-47917526 AAGGGTTGTTATGAAAATTAAGG - Intronic
1097716587 12:62972503-62972525 GAGGGTTGTTGTGGAGCTAAAGG + Intergenic
1097939981 12:65293626-65293648 GAGGGATGTACTGTAGCTTGTGG - Intronic
1101722303 12:107360551-107360573 CAGGGTTGTGTTGGAGCTTGGGG - Intronic
1102565364 12:113794106-113794128 GGAGGTTGTCAAGAAGCTTGGGG + Intergenic
1105652534 13:22395628-22395650 GAGGGCTGTTACTAAGCCTGTGG + Intergenic
1110283368 13:73721095-73721117 GAGGGTTGCTCTGAAGCTTAAGG - Intronic
1118412571 14:65497005-65497027 TAGGGTTGTGATGAAGTTTAAGG + Intronic
1122790557 14:104182527-104182549 GTGGGGTGTGATGGAGCTTGGGG + Intergenic
1126634581 15:50768155-50768177 GTGGGTTGGTCTGAAGCTTAGGG + Intergenic
1127366679 15:58298082-58298104 GAGAGTTGTTGTGAAAATTGAGG - Intronic
1128183547 15:65625303-65625325 CAGGGCTGTTGTGAGGCTTGGGG - Exonic
1128922880 15:71628352-71628374 TAGGGTTGCTATGAAACATGAGG - Intronic
1134210990 16:12276636-12276658 GATGCTTGTTTTGAGGCTTGAGG + Intronic
1136222001 16:28835069-28835091 GTGGGTTGCTCTGAAGCATGGGG - Exonic
1140677972 16:77352517-77352539 AAGGGTTTTTGTGAAGATTGAGG + Intronic
1146242759 17:31245338-31245360 GATGGTTGTTAGGAAGCCAGAGG - Intronic
1151434962 17:74089458-74089480 GAGGGTTGTTATGCAGATTAGGG - Intergenic
1155085878 18:22457630-22457652 GAGGGATGTTATGAATATTAAGG - Intergenic
1157717320 18:49896951-49896973 GAGGGTGGTTATCAAGATTAGGG + Intronic
1158306336 18:56110097-56110119 CAGGGTTCTCATGGAGCTTGGGG + Intergenic
1158405686 18:57157363-57157385 GAGGATTGTTAGGAAGGTTTTGG - Intergenic
1161122585 19:2537674-2537696 GGGGGTTGTGGTGAAGCTGGAGG + Intronic
1163949007 19:20566962-20566984 GAGAGGTCTTATGAAGCTTCAGG - Intronic
925301930 2:2823144-2823166 GAGGATTGTTCTGAGCCTTGCGG - Intergenic
926886351 2:17602271-17602293 GAGGGTTGTTATGAAGCTTGTGG + Intronic
930730262 2:54722649-54722671 GAGGGTTGTCTTAAAACTTGAGG + Intergenic
930776513 2:55177373-55177395 GAGTATCTTTATGAAGCTTGAGG - Intronic
935577222 2:104723492-104723514 GAGGGTTTTATTGGAGCTTGGGG - Intergenic
935614166 2:105059498-105059520 CAGGATTGTTTTGAAGCTTATGG + Intronic
936687992 2:114850619-114850641 GGGGGTTGGTATGAACTTTGTGG + Intronic
937037268 2:118792601-118792623 GAGGCTTGTTAGGGAGCTTGAGG + Intergenic
944936894 2:204578982-204579004 GAGAGTTGTCAGGAAGCGTGTGG + Intronic
948158391 2:235802955-235802977 GATGGTTGTGATGATGGTTGTGG + Intronic
948435227 2:237948734-237948756 GAGGTTTGTTATACAGCTTTGGG + Intergenic
1172936357 20:38623285-38623307 GGGGGTTGTGCTGAGGCTTGTGG - Intronic
1175458737 20:59134892-59134914 GAGGGTTGTGGTGAGGATTGAGG + Intergenic
1175539342 20:59738501-59738523 CAGGGTTGTTATGATGCAGGTGG + Intronic
1176853718 21:13945219-13945241 GAGGGTTTAAATGAAGCTTAAGG + Intergenic
1178260714 21:31097584-31097606 GAGTGATGTGATGAAGCCTGAGG - Intergenic
1179915230 21:44473121-44473143 GAGGGTTATCCTGAGGCTTGGGG + Intergenic
1182422123 22:30253776-30253798 GAGGATTGTTCTGAGGATTGTGG + Intergenic
1183052473 22:35275024-35275046 TAGGGTTGTTATGAGGTTTAAGG + Intronic
1184264511 22:43339873-43339895 GAGGGTTGGAGTGATGCTTGTGG - Intronic
1185408644 22:50671716-50671738 GAGGGTCCTCAGGAAGCTTGGGG + Intergenic
949421598 3:3872059-3872081 GAGGGTTGTTAGGAATGATGAGG - Intronic
951294232 3:20914379-20914401 TAGGGCTGTTTTCAAGCTTGTGG - Intergenic
952845808 3:37686947-37686969 GTGGGTTGTTAAGCAGGTTGGGG - Intronic
953853034 3:46480346-46480368 AAGGGTAGTTAGGAAGGTTGCGG - Intronic
956289163 3:67643726-67643748 GTGGGTTTGTAGGAAGCTTGGGG - Intronic
957740149 3:84255345-84255367 GAGGCTTGATATAAAGGTTGTGG - Intergenic
960383639 3:116993740-116993762 GAGGGCCATTATGAAGCTTAAGG - Intronic
962410989 3:135141703-135141725 GAGGCATGCTATGAAGTTTGAGG + Intronic
965963801 3:174461070-174461092 GAAGGTCCTTATGCAGCTTGAGG + Intronic
967924928 3:194638577-194638599 AAGAATTGTCATGAAGCTTGTGG - Intergenic
970715583 4:18918494-18918516 AAGGGTTGTAATGAAGATTCTGG - Intergenic
973685604 4:53366480-53366502 AGGGTTTGTTATGAGGCTTGTGG - Intergenic
973862826 4:55082715-55082737 GAAGGTTGCTATTAAGTTTGTGG - Intronic
974726250 4:65802363-65802385 GTGGATTGTTATAAAGCCTGAGG + Intergenic
975823497 4:78295489-78295511 GGGGATTCTTATGAAGCATGTGG + Intronic
977246974 4:94644175-94644197 CAGGGTTGTTATGAAAATTCAGG - Intronic
978637106 4:110822748-110822770 GAGTGTGATTCTGAAGCTTGGGG + Intergenic
979318926 4:119300542-119300564 TAGGGTTGTTACGAAGCTGCAGG - Exonic
982121740 4:152149916-152149938 CAGGGTTGTTCTGCAGCTGGGGG - Intergenic
982474419 4:155832938-155832960 GAGGGTTGTTCTCAGGGTTGTGG - Intronic
982644101 4:158000818-158000840 GGAGGGTGTTTTGAAGCTTGTGG + Intergenic
987246569 5:16054955-16054977 GAGGGTCGTTATTAAGGTGGTGG + Intergenic
987319461 5:16754617-16754639 GAGTGATGTTATTAAGCTTTAGG - Intronic
988241254 5:28612352-28612374 GAGGTTTGATATGAACTTTGTGG + Intergenic
988903611 5:35761311-35761333 GAGGGTTGTTGTGAAGATTATGG + Intronic
990219171 5:53567980-53568002 GAAAGTTGTTATGAAGAATGTGG - Intronic
993153580 5:84192528-84192550 GAGAGTTGATATGAAACTTTGGG - Intronic
994452096 5:99955866-99955888 CAGGGTTGACCTGAAGCTTGGGG - Intergenic
999254336 5:150201647-150201669 AAGGGTTCTTATCAAGCTTACGG + Intronic
999278334 5:150347275-150347297 CAGGGGTGTTATGAGGCTGGAGG - Intergenic
1002181176 5:177431855-177431877 GAGGGTTCTGAAGAAGATTGTGG + Intronic
1011156673 6:84341058-84341080 GAGGCTTGTATTGTAGCTTGGGG - Intergenic
1013364989 6:109430343-109430365 GAGGATAGTCATGAAGCATGAGG - Intronic
1014865561 6:126525339-126525361 CAGGGTGGTTGTGAAGCTGGAGG + Intergenic
1015154033 6:130070996-130071018 TCGAGTTGGTATGAAGCTTGAGG + Exonic
1016634452 6:146271426-146271448 GAGACTTGTTAGGAAGCTGGTGG + Intronic
1022088839 7:27094859-27094881 GAGTGTTGCCATGAAGCGTGTGG - Intronic
1023204427 7:37732862-37732884 GAAGGTTATTACAAAGCTTGAGG + Intronic
1023917498 7:44601088-44601110 GAGGGTTGGTGTGCAGCTTTTGG - Intergenic
1024853843 7:53753968-53753990 GATGGTTGTCATAAAGCGTGAGG + Intergenic
1026934245 7:74243441-74243463 GAGGGTTGTTCTGATGCTGTAGG - Intronic
1030698352 7:112611124-112611146 GAGGTTGGTTATGAGGCTTAAGG + Intergenic
1033112884 7:138597986-138598008 GAGTCTTGTTACGAAGCTTCAGG - Intronic
1033396833 7:140982759-140982781 AAGGGTTGTTATAAAACTTGGGG + Intergenic
1034430092 7:151036811-151036833 GAGGGTTGTTATGGGCCCTGAGG - Intronic
1042370309 8:67983900-67983922 TAGGGTTGCTGTGAAGATTGAGG + Intronic
1043185530 8:77143621-77143643 GAAGGTTGGTATGAAGCAAGAGG - Intergenic
1043392985 8:79809224-79809246 GAGGGTAGTTGTCAAGTTTGGGG + Intergenic
1045706159 8:104925783-104925805 GAGGGTTGTAATGAATTTGGAGG - Intronic
1046405395 8:113766081-113766103 GAGGGTGGATATGGAGTTTGTGG + Intergenic
1047554526 8:125914635-125914657 CAGGGCTGATATGAAGCCTGGGG + Intergenic
1047831286 8:128633273-128633295 GAGGGTTGTCATGAATAATGTGG - Intergenic
1047837820 8:128713691-128713713 AGGGGTTGTAATGAGGCTTGTGG - Intergenic
1049113636 8:140666591-140666613 GGGGGTTATTTTGAAGCTTGGGG - Intronic
1049534833 8:143174300-143174322 TAGGGTTCTTATGAAGCTGAAGG + Intergenic
1051431547 9:16985130-16985152 CAGGGTTGTTATAAAGCATAGGG + Intergenic
1194766625 X:97849245-97849267 GAGGGTTTTTATAGAGCGTGTGG - Intergenic
1196194804 X:112828389-112828411 TAGGGTTGTTATAAAGATTAAGG + Intronic
1197694775 X:129539310-129539332 GAAGGTTGATATGCAGCGTGTGG - Intergenic