ID: 926886924

View in Genome Browser
Species Human (GRCh38)
Location 2:17606491-17606513
Sequence GGAACCTAAGCTAGAAGTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 103}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926886924_926886928 20 Left 926886924 2:17606491-17606513 CCTACACTTCTAGCTTAGGTTCC 0: 1
1: 0
2: 0
3: 11
4: 103
Right 926886928 2:17606534-17606556 GAGTCAGAAGAAAACCAAGGTGG 0: 1
1: 2
2: 2
3: 39
4: 355
926886924_926886927 17 Left 926886924 2:17606491-17606513 CCTACACTTCTAGCTTAGGTTCC 0: 1
1: 0
2: 0
3: 11
4: 103
Right 926886927 2:17606531-17606553 GTTGAGTCAGAAGAAAACCAAGG 0: 1
1: 0
2: 0
3: 25
4: 241
926886924_926886925 -7 Left 926886924 2:17606491-17606513 CCTACACTTCTAGCTTAGGTTCC 0: 1
1: 0
2: 0
3: 11
4: 103
Right 926886925 2:17606507-17606529 AGGTTCCTTGTTGACAGCACTGG 0: 1
1: 0
2: 0
3: 15
4: 157
926886924_926886929 21 Left 926886924 2:17606491-17606513 CCTACACTTCTAGCTTAGGTTCC 0: 1
1: 0
2: 0
3: 11
4: 103
Right 926886929 2:17606535-17606557 AGTCAGAAGAAAACCAAGGTGGG 0: 1
1: 1
2: 7
3: 37
4: 379

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926886924 Original CRISPR GGAACCTAAGCTAGAAGTGT AGG (reversed) Intronic