ID: 926886925 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:17606507-17606529 |
| Sequence | AGGTTCCTTGTTGACAGCAC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 173 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 15, 4: 157} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 926886922_926886925 | 18 | Left | 926886922 | 2:17606466-17606488 | CCAGGAGGCTGAGGGTCTGACAG | 0: 1 1: 0 2: 0 3: 27 4: 354 |
||
| Right | 926886925 | 2:17606507-17606529 | AGGTTCCTTGTTGACAGCACTGG | 0: 1 1: 0 2: 0 3: 15 4: 157 |
||||
| 926886924_926886925 | -7 | Left | 926886924 | 2:17606491-17606513 | CCTACACTTCTAGCTTAGGTTCC | 0: 1 1: 0 2: 0 3: 11 4: 103 |
||
| Right | 926886925 | 2:17606507-17606529 | AGGTTCCTTGTTGACAGCACTGG | 0: 1 1: 0 2: 0 3: 15 4: 157 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 926886925 | Original CRISPR | AGGTTCCTTGTTGACAGCAC TGG | Intronic | ||