ID: 926886925

View in Genome Browser
Species Human (GRCh38)
Location 2:17606507-17606529
Sequence AGGTTCCTTGTTGACAGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 157}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926886922_926886925 18 Left 926886922 2:17606466-17606488 CCAGGAGGCTGAGGGTCTGACAG 0: 1
1: 0
2: 0
3: 27
4: 354
Right 926886925 2:17606507-17606529 AGGTTCCTTGTTGACAGCACTGG 0: 1
1: 0
2: 0
3: 15
4: 157
926886924_926886925 -7 Left 926886924 2:17606491-17606513 CCTACACTTCTAGCTTAGGTTCC 0: 1
1: 0
2: 0
3: 11
4: 103
Right 926886925 2:17606507-17606529 AGGTTCCTTGTTGACAGCACTGG 0: 1
1: 0
2: 0
3: 15
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926886925 Original CRISPR AGGTTCCTTGTTGACAGCAC TGG Intronic