ID: 926886927

View in Genome Browser
Species Human (GRCh38)
Location 2:17606531-17606553
Sequence GTTGAGTCAGAAGAAAACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 241}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926886926_926886927 -4 Left 926886926 2:17606512-17606534 CCTTGTTGACAGCACTGGAGTTG 0: 1
1: 0
2: 0
3: 13
4: 166
Right 926886927 2:17606531-17606553 GTTGAGTCAGAAGAAAACCAAGG 0: 1
1: 0
2: 0
3: 25
4: 241
926886924_926886927 17 Left 926886924 2:17606491-17606513 CCTACACTTCTAGCTTAGGTTCC 0: 1
1: 0
2: 0
3: 11
4: 103
Right 926886927 2:17606531-17606553 GTTGAGTCAGAAGAAAACCAAGG 0: 1
1: 0
2: 0
3: 25
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926886927 Original CRISPR GTTGAGTCAGAAGAAAACCA AGG Intronic