ID: 926886928 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:17606534-17606556 |
| Sequence | GAGTCAGAAGAAAACCAAGG TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 399 | |||
| Summary | {0: 1, 1: 2, 2: 2, 3: 39, 4: 355} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 926886924_926886928 | 20 | Left | 926886924 | 2:17606491-17606513 | CCTACACTTCTAGCTTAGGTTCC | 0: 1 1: 0 2: 0 3: 11 4: 103 |
||
| Right | 926886928 | 2:17606534-17606556 | GAGTCAGAAGAAAACCAAGGTGG | 0: 1 1: 2 2: 2 3: 39 4: 355 |
||||
| 926886926_926886928 | -1 | Left | 926886926 | 2:17606512-17606534 | CCTTGTTGACAGCACTGGAGTTG | 0: 1 1: 0 2: 0 3: 13 4: 166 |
||
| Right | 926886928 | 2:17606534-17606556 | GAGTCAGAAGAAAACCAAGGTGG | 0: 1 1: 2 2: 2 3: 39 4: 355 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 926886928 | Original CRISPR | GAGTCAGAAGAAAACCAAGG TGG | Intronic | ||