ID: 926886928

View in Genome Browser
Species Human (GRCh38)
Location 2:17606534-17606556
Sequence GAGTCAGAAGAAAACCAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 399
Summary {0: 1, 1: 2, 2: 2, 3: 39, 4: 355}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926886924_926886928 20 Left 926886924 2:17606491-17606513 CCTACACTTCTAGCTTAGGTTCC 0: 1
1: 0
2: 0
3: 11
4: 103
Right 926886928 2:17606534-17606556 GAGTCAGAAGAAAACCAAGGTGG 0: 1
1: 2
2: 2
3: 39
4: 355
926886926_926886928 -1 Left 926886926 2:17606512-17606534 CCTTGTTGACAGCACTGGAGTTG 0: 1
1: 0
2: 0
3: 13
4: 166
Right 926886928 2:17606534-17606556 GAGTCAGAAGAAAACCAAGGTGG 0: 1
1: 2
2: 2
3: 39
4: 355

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926886928 Original CRISPR GAGTCAGAAGAAAACCAAGG TGG Intronic