ID: 926886929 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:17606535-17606557 |
Sequence | AGTCAGAAGAAAACCAAGGT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 425 | |||
Summary | {0: 1, 1: 1, 2: 7, 3: 37, 4: 379} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
926886924_926886929 | 21 | Left | 926886924 | 2:17606491-17606513 | CCTACACTTCTAGCTTAGGTTCC | 0: 1 1: 0 2: 0 3: 11 4: 103 |
||
Right | 926886929 | 2:17606535-17606557 | AGTCAGAAGAAAACCAAGGTGGG | 0: 1 1: 1 2: 7 3: 37 4: 379 |
||||
926886926_926886929 | 0 | Left | 926886926 | 2:17606512-17606534 | CCTTGTTGACAGCACTGGAGTTG | 0: 1 1: 0 2: 0 3: 13 4: 166 |
||
Right | 926886929 | 2:17606535-17606557 | AGTCAGAAGAAAACCAAGGTGGG | 0: 1 1: 1 2: 7 3: 37 4: 379 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
926886929 | Original CRISPR | AGTCAGAAGAAAACCAAGGT GGG | Intronic | ||