ID: 926886929

View in Genome Browser
Species Human (GRCh38)
Location 2:17606535-17606557
Sequence AGTCAGAAGAAAACCAAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 425
Summary {0: 1, 1: 1, 2: 7, 3: 37, 4: 379}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926886924_926886929 21 Left 926886924 2:17606491-17606513 CCTACACTTCTAGCTTAGGTTCC 0: 1
1: 0
2: 0
3: 11
4: 103
Right 926886929 2:17606535-17606557 AGTCAGAAGAAAACCAAGGTGGG 0: 1
1: 1
2: 7
3: 37
4: 379
926886926_926886929 0 Left 926886926 2:17606512-17606534 CCTTGTTGACAGCACTGGAGTTG 0: 1
1: 0
2: 0
3: 13
4: 166
Right 926886929 2:17606535-17606557 AGTCAGAAGAAAACCAAGGTGGG 0: 1
1: 1
2: 7
3: 37
4: 379

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926886929 Original CRISPR AGTCAGAAGAAAACCAAGGT GGG Intronic