ID: 926887275

View in Genome Browser
Species Human (GRCh38)
Location 2:17609796-17609818
Sequence CTTCATATGCTGTAGGTGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 137}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926887269_926887275 2 Left 926887269 2:17609771-17609793 CCATAAAGGTCCCACCAATTGAT 0: 1
1: 0
2: 0
3: 17
4: 120
Right 926887275 2:17609796-17609818 CTTCATATGCTGTAGGTGATGGG 0: 1
1: 0
2: 0
3: 6
4: 137
926887270_926887275 -8 Left 926887270 2:17609781-17609803 CCCACCAATTGATCACTTCATAT 0: 1
1: 0
2: 0
3: 8
4: 140
Right 926887275 2:17609796-17609818 CTTCATATGCTGTAGGTGATGGG 0: 1
1: 0
2: 0
3: 6
4: 137
926887267_926887275 27 Left 926887267 2:17609746-17609768 CCAAATAGAGAGAATTATACTGT 0: 1
1: 0
2: 1
3: 17
4: 226
Right 926887275 2:17609796-17609818 CTTCATATGCTGTAGGTGATGGG 0: 1
1: 0
2: 0
3: 6
4: 137
926887271_926887275 -9 Left 926887271 2:17609782-17609804 CCACCAATTGATCACTTCATATG 0: 1
1: 0
2: 0
3: 7
4: 132
Right 926887275 2:17609796-17609818 CTTCATATGCTGTAGGTGATGGG 0: 1
1: 0
2: 0
3: 6
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926887275 Original CRISPR CTTCATATGCTGTAGGTGAT GGG Intronic
903387271 1:22935661-22935683 CTTCATAGGCTGTAGCCAATTGG + Intergenic
905492692 1:38356844-38356866 CCTTATATTTTGTAGGTGATGGG + Intergenic
906057731 1:42929725-42929747 CTTCATCTCCTGCAGGTCATGGG + Exonic
906396739 1:45472681-45472703 CATCATATCCTTTAGGTGAATGG - Intronic
907314874 1:53561868-53561890 ATTCATATGCTCTAGGTGCGTGG - Intronic
909638363 1:77843633-77843655 TTTCATATACTGTAGATTATGGG + Intronic
910504835 1:87938293-87938315 TTTCATATGCTGAAGGAAATGGG + Intergenic
910800276 1:91138277-91138299 CTTCATATGTTGTAAGGGAGAGG - Intergenic
912949491 1:114110993-114111015 CTTCAGCTGCTGTATATGATTGG - Intronic
914410177 1:147419808-147419830 TTTCTCAGGCTGTAGGTGATGGG - Intergenic
920397371 1:205657213-205657235 ATTCCCATGCTGTGGGTGATGGG + Intergenic
920918360 1:210276935-210276957 CTTCATATGGTGGAAGGGATGGG - Intergenic
1064129164 10:12692835-12692857 CTTCTAATGTTGTAGGTAATAGG + Intronic
1065213050 10:23423070-23423092 CTTAATATGCGCTAGGTGCTGGG - Intergenic
1070268482 10:74927792-74927814 CTTCCTAGGCTGGAGGAGATAGG - Intronic
1073637369 10:105213641-105213663 CTTCATATGCTGGGGTTGGTGGG + Intronic
1074172869 10:110961046-110961068 CTTCATATGCGGTAGTTATTAGG + Intronic
1075982760 10:126755573-126755595 CTGCAGCTGCTGTAGGGGATGGG + Intergenic
1077061671 11:620298-620320 CTAAAGATGCTGTAGATGATGGG + Exonic
1077918591 11:6626593-6626615 CTGAGAATGCTGTAGGTGATGGG + Exonic
1083072846 11:60004007-60004029 CTACAGCTGCTGTAGGGGATGGG - Intergenic
1087206763 11:95404545-95404567 CTGCAGCTGCTGTAGGAGATGGG + Intergenic
1087609991 11:100422638-100422660 CTGCAGCTGCTGTAGGGGATGGG - Intergenic
1087611297 11:100437074-100437096 CTCTTTATGCTTTAGGTGATTGG + Intergenic
1089438358 11:118492151-118492173 CTTTATACTCTGAAGGTGATAGG + Intronic
1090175990 11:124650250-124650272 CTGCAGATCCTGTAAGTGATGGG - Intronic
1093001809 12:14005560-14005582 ATTCATATTCTGCAGGTGTTGGG + Intergenic
1097765182 12:63518280-63518302 CTTCAAATGATGTATGTAATGGG - Intergenic
1099247364 12:80209262-80209284 CTTCAGATGCTGTATGTAGTTGG + Intergenic
1099958086 12:89370696-89370718 CTTCATATCCTGCAGGAGAAAGG + Intergenic
1099985566 12:89658931-89658953 CTGCATAATTTGTAGGTGATTGG - Intronic
1100309844 12:93384047-93384069 CTTCAGAGGCTGTAGGTCCTTGG - Intronic
1109602141 13:64644887-64644909 CCTCACATGCTATAGGTGTTAGG - Intergenic
1109875200 13:68393715-68393737 TTTCAAATTCTGTTGGTGATTGG - Intergenic
1110416484 13:75259220-75259242 CTGCCTTTGCTGTAGGTGCTGGG - Intergenic
1112035372 13:95492337-95492359 CTTCAGCTGCTGTGGGGGATGGG + Intronic
1115420540 14:33189338-33189360 GTTCATACGCTATAGGTGAGAGG + Intronic
1121278851 14:92685943-92685965 CTTCATATGCAGAGGATGATAGG - Intronic
1128920008 15:71602006-71602028 CTTCACATGATGTAGGAGGTGGG + Intronic
1130354039 15:83113879-83113901 CTCCCTATGCTGTTGCTGATGGG - Intronic
1130581103 15:85137370-85137392 CTTCATGTGGTGCAGGTGAAAGG + Intronic
1130969566 15:88721384-88721406 CTTCCTTTTGTGTAGGTGATGGG - Intergenic
1132013281 15:98294264-98294286 CTTCATCTGCTGCAAGTGCTGGG + Intergenic
1134161692 16:11895590-11895612 CCTCATTTGCTGTAAGTGAAAGG - Intronic
1135973545 16:27089741-27089763 CTATTGATGCTGTAGGTGATGGG - Intergenic
1136550124 16:30978581-30978603 GTTCAAATTCTGTAGGGGATGGG + Intronic
1138146732 16:54619333-54619355 CCTCATATCCTGTAGGTCAGGGG - Intergenic
1141052538 16:80784678-80784700 CCTCTTATGCTCTAGGTGCTGGG + Intronic
1142266205 16:89065056-89065078 CTCCACATGCTGTGGGTGGTGGG - Intergenic
1144253743 17:13445038-13445060 TCTCATATGATCTAGGTGATGGG - Intergenic
1145757272 17:27401810-27401832 CTTCATTTTCTGTTGTTGATGGG - Intergenic
1149123009 17:53192595-53192617 CTTCATTTGCAGTAGTTGAATGG - Intergenic
1157732277 18:50014575-50014597 CTTCATTTACTGCAGGAGATAGG - Intronic
1158228741 18:55229854-55229876 ATTCATAAGCTGCAGGTGTTTGG - Intronic
1159130437 18:64275277-64275299 CTAGATATGCTGTAGGAGCTCGG + Intergenic
1164061093 19:21674848-21674870 CCTAATATGTTGTAGGTAATTGG - Intergenic
1167473482 19:49687745-49687767 CTTCATGTGCTGGAGGGTATGGG + Intronic
1167935772 19:52906027-52906049 GTTCATACGCTGTAGTTCATGGG - Intergenic
926887275 2:17609796-17609818 CTTCATATGCTGTAGGTGATGGG + Intronic
934803782 2:97196910-97196932 CTTCATTTGCAGTAGGTTCTTGG + Intronic
936455108 2:112666998-112667020 CTTCAAAGTCTGTTGGTGATTGG + Intergenic
937510111 2:122586150-122586172 CTTTATATGCTATAAGTCATAGG - Intergenic
938844736 2:135196722-135196744 CTTCATATAGTTTAGGTGTTTGG + Intronic
939501339 2:142988830-142988852 CTTCATTTGCATTAGGAGATCGG + Intronic
939769565 2:146298850-146298872 CTGCAGCTGCTGTTGGTGATGGG - Intergenic
941056083 2:160790510-160790532 CTTCATTTGCTGTAAGTCCTTGG - Intergenic
941919438 2:170834699-170834721 TTTCATGTAATGTAGGTGATGGG - Intronic
942315660 2:174694268-174694290 CTTCATCTGCTTTAGGTATTGGG - Intergenic
943748141 2:191483747-191483769 CTTCATTTGCTATAGCTTATAGG + Intergenic
945125383 2:206503929-206503951 CTTTATAGGTTTTAGGTGATCGG - Intronic
946876296 2:224132999-224133021 GATCTTATCCTGTAGGTGATAGG + Intergenic
1168782862 20:509438-509460 CAGCACATGCTGTAGGAGATAGG - Intronic
1169886238 20:10401310-10401332 ATTCAAATTCTGTAGATGATTGG + Exonic
1170596256 20:17807921-17807943 CTTCATATGTGGTCAGTGATGGG + Intergenic
1174115102 20:48221384-48221406 GTTCATGTGCTGTAGGTGGGTGG - Intergenic
1177303413 21:19281121-19281143 CTTCATTTGATGCAGGAGATTGG + Intergenic
1177399949 21:20590381-20590403 ATTCATACGCTGTAATTGATAGG + Intergenic
1178801676 21:35801387-35801409 CTGCAGCTGCTGTAGGGGATGGG - Intronic
1181168368 22:20995071-20995093 GTTCATCTGCGGTAGGAGATTGG + Intronic
1182562272 22:31169868-31169890 CTGCATCTGCTGTAGATGACAGG + Intronic
950551755 3:13670267-13670289 CTTCTTCTGCATTAGGTGATGGG + Intergenic
956286384 3:67614622-67614644 CTTCACAGGCTGAAGGTGAAGGG + Intronic
957699632 3:83691958-83691980 CTGCTTTTGCTGTAGGTCATAGG - Intergenic
958775947 3:98483144-98483166 CTGCAGCTGCTGTGGGTGATGGG + Intergenic
959128117 3:102316074-102316096 CTTCATGTGTTGTAGGTGAGAGG + Intronic
959229231 3:103626320-103626342 CTTCATAGGCTGTATGTGTCTGG + Intergenic
960530571 3:118759472-118759494 TTTCAAATGCTGCAGGTGCTGGG - Intergenic
961372738 3:126441296-126441318 CTTTCTATGCTGAAGGTGGTGGG - Intronic
961500364 3:127328266-127328288 CTGGACATGCTGTAGGTGCTTGG - Intergenic
962034448 3:131636462-131636484 CTGCAGCTGCTGTGGGTGATGGG - Intronic
962362435 3:134753541-134753563 TGTCTTATGCTCTAGGTGATGGG - Intronic
965184560 3:165446529-165446551 CTGCAGCTGCTGTAGGGGATGGG - Intergenic
966594554 3:181713451-181713473 TGTCATTTGCTGTGGGTGATGGG - Exonic
970549317 4:17163591-17163613 CTGCAGCTGCTGTAGGGGATGGG + Intergenic
972347367 4:38203890-38203912 TTTCAAAAGCTGTAGGTGATAGG + Intergenic
976472654 4:85447698-85447720 ATGCATATCCTGTAGGTTATTGG + Intergenic
976864789 4:89711089-89711111 CTTCACCTGCTGCAGTTGATTGG + Intergenic
978670701 4:111244434-111244456 CTGCAGCTGCTGTAGGGGATGGG - Intergenic
980936213 4:139228114-139228136 ATTCAGATGCTGTGTGTGATGGG - Intergenic
982239161 4:153281208-153281230 TTTCATATGCTGTGGGTGGAAGG + Intronic
984323570 4:178224385-178224407 CTGCAGCTGCTGTAGGGGATGGG - Intergenic
985561905 5:592242-592264 CTGCAGCTGCTGTAGGAGATGGG + Intergenic
987036062 5:14019473-14019495 CTTAATGTGCTATATGTGATGGG + Intergenic
992159465 5:73986636-73986658 CTTCCTATGATGTAGATGACAGG + Intergenic
992317613 5:75573912-75573934 CTTGAGATTCTGTAGGTGACAGG - Intronic
994616945 5:102115837-102115859 CTGCATAAGCTGTCGGTTATTGG - Intergenic
994883573 5:105529263-105529285 CTGCAGTTGCTGTGGGTGATAGG + Intergenic
998783872 5:145688118-145688140 CTTCAGCTGCTGTGGGTGATGGG + Intronic
1001876415 5:175205683-175205705 TTTCATATGCTCTAGGTTATGGG + Intergenic
1009646432 6:66408796-66408818 CTTTCTATGCTTTATGTGATTGG - Intergenic
1012438319 6:99238256-99238278 CTTCATATACTGTGGGAGATGGG - Intergenic
1012922680 6:105235441-105235463 CTGCAGCTGCTGTGGGTGATGGG - Intergenic
1013659473 6:112280196-112280218 TTTCATATGCTGTAGATAAAAGG - Intergenic
1013856681 6:114581283-114581305 CTGCAGCTGCTGTAGGGGATGGG - Intergenic
1016189575 6:141246971-141246993 CTTCATATGCTCTAAGAAATTGG - Intergenic
1016234702 6:141849343-141849365 TTACATTTACTGTAGGTGATGGG + Intergenic
1016584670 6:145670561-145670583 CTTCATACACTTTAGCTGATAGG + Intronic
1016789787 6:148056027-148056049 CTTAATATGCTGGAGGGGAGAGG + Intergenic
1021113145 7:16718709-16718731 CTTTTTATGCTCTAGTTGATTGG + Intergenic
1023138692 7:37079678-37079700 TGTCATATGCTGCAGGTGATGGG - Intronic
1024397795 7:48889252-48889274 CTTCATATGGTGTTGGGGGTGGG - Intergenic
1024425374 7:49219458-49219480 TTTACTATGCTTTAGGTGATAGG - Intergenic
1026145542 7:67743430-67743452 CCTCAGCTGCTCTAGGTGATTGG + Intergenic
1028747613 7:94345959-94345981 CTTCATAGGCTGGAGGTGGGTGG - Intergenic
1029002201 7:97166242-97166264 CATCATATGCCCTAGGTGGTTGG + Intronic
1033458593 7:141525040-141525062 CTTGAAATGTTCTAGGTGATAGG + Intergenic
1036898976 8:12657879-12657901 CTTCTTATCCTGTCCGTGATTGG + Intergenic
1038204440 8:25452474-25452496 GTTCAGATGCTGCAGGTGACAGG - Intronic
1042831216 8:73030907-73030929 CTTCATGTGGAGGAGGTGATTGG + Intronic
1043233016 8:77826071-77826093 GATCATATGCTCAAGGTGATTGG - Intergenic
1048425864 8:134322813-134322835 TTTTATAGGCTGTAGATGATTGG + Intergenic
1051563388 9:18468789-18468811 CTTCTCATACTGTAGGTGCTTGG - Intergenic
1056878771 9:90367574-90367596 CTTCATTTGCTAGAGGTGTTTGG + Intergenic
1059280295 9:113127152-113127174 GATCATATGCTATAGGTCATGGG - Intergenic
1059334073 9:113557690-113557712 TTTCATATGCTGTTCATGATTGG - Intronic
1062036049 9:134383035-134383057 GATCACATGCTGTGGGTGATTGG + Intronic
1187234320 X:17452763-17452785 CTTCTCATGCTATAGTTGATTGG - Intronic
1187625313 X:21105600-21105622 CTGCATATGATGTAGAGGATAGG + Intergenic
1190448929 X:50558074-50558096 CTGCAGCTGCTGTGGGTGATGGG - Intergenic
1193824374 X:86205318-86205340 CTTCTTATTCTGGAGGGGATGGG - Intronic
1196231892 X:113233648-113233670 CTGCAGCTGCTGTGGGTGATGGG + Intergenic
1197069971 X:122285063-122285085 CTTCAGGTTCTGAAGGTGATTGG + Intergenic
1197827096 X:130601320-130601342 CTTCATTTGCTGTATGTTCTTGG + Intergenic
1201904107 Y:19072507-19072529 TTTCAGATGCTGTAAGGGATGGG - Intergenic