ID: 926887294

View in Genome Browser
Species Human (GRCh38)
Location 2:17609920-17609942
Sequence CTTTATCCCCACATGGAGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 161}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926887286_926887294 -4 Left 926887286 2:17609901-17609923 CCTGCACCCACTCCCCAGCCTTT 0: 1
1: 0
2: 8
3: 118
4: 1006
Right 926887294 2:17609920-17609942 CTTTATCCCCACATGGAGCCCGG 0: 1
1: 0
2: 0
3: 16
4: 161
926887282_926887294 21 Left 926887282 2:17609876-17609898 CCACTGCCATCATCTCTACCCTT 0: 1
1: 0
2: 4
3: 54
4: 537
Right 926887294 2:17609920-17609942 CTTTATCCCCACATGGAGCCCGG 0: 1
1: 0
2: 0
3: 16
4: 161
926887279_926887294 24 Left 926887279 2:17609873-17609895 CCCCCACTGCCATCATCTCTACC 0: 1
1: 1
2: 9
3: 119
4: 1132
Right 926887294 2:17609920-17609942 CTTTATCCCCACATGGAGCCCGG 0: 1
1: 0
2: 0
3: 16
4: 161
926887283_926887294 15 Left 926887283 2:17609882-17609904 CCATCATCTCTACCCTTTTCCTG 0: 1
1: 1
2: 4
3: 56
4: 565
Right 926887294 2:17609920-17609942 CTTTATCCCCACATGGAGCCCGG 0: 1
1: 0
2: 0
3: 16
4: 161
926887287_926887294 -10 Left 926887287 2:17609907-17609929 CCCACTCCCCAGCCTTTATCCCC 0: 1
1: 0
2: 4
3: 49
4: 482
Right 926887294 2:17609920-17609942 CTTTATCCCCACATGGAGCCCGG 0: 1
1: 0
2: 0
3: 16
4: 161
926887285_926887294 2 Left 926887285 2:17609895-17609917 CCTTTTCCTGCACCCACTCCCCA 0: 1
1: 1
2: 10
3: 102
4: 957
Right 926887294 2:17609920-17609942 CTTTATCCCCACATGGAGCCCGG 0: 1
1: 0
2: 0
3: 16
4: 161
926887278_926887294 25 Left 926887278 2:17609872-17609894 CCCCCCACTGCCATCATCTCTAC 0: 1
1: 0
2: 2
3: 38
4: 373
Right 926887294 2:17609920-17609942 CTTTATCCCCACATGGAGCCCGG 0: 1
1: 0
2: 0
3: 16
4: 161
926887281_926887294 22 Left 926887281 2:17609875-17609897 CCCACTGCCATCATCTCTACCCT 0: 1
1: 0
2: 3
3: 51
4: 312
Right 926887294 2:17609920-17609942 CTTTATCCCCACATGGAGCCCGG 0: 1
1: 0
2: 0
3: 16
4: 161
926887280_926887294 23 Left 926887280 2:17609874-17609896 CCCCACTGCCATCATCTCTACCC 0: 1
1: 0
2: 2
3: 54
4: 475
Right 926887294 2:17609920-17609942 CTTTATCCCCACATGGAGCCCGG 0: 1
1: 0
2: 0
3: 16
4: 161
926887284_926887294 3 Left 926887284 2:17609894-17609916 CCCTTTTCCTGCACCCACTCCCC 0: 1
1: 0
2: 3
3: 157
4: 1536
Right 926887294 2:17609920-17609942 CTTTATCCCCACATGGAGCCCGG 0: 1
1: 0
2: 0
3: 16
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926887294 Original CRISPR CTTTATCCCCACATGGAGCC CGG Intronic
900165765 1:1243753-1243775 CTTTATGCCCAGACGGAGCGTGG - Intronic
902043690 1:13510227-13510249 CCTTGTACCCTCATGGAGCCTGG + Intronic
902764494 1:18605522-18605544 CTTCATCCCCTCAGGGAGCTGGG + Intergenic
903405900 1:23095715-23095737 CTTTAACCCCTAATAGAGCCCGG - Intronic
903694942 1:25199648-25199670 CTTTCTCCCCACGTGGAGGATGG + Intergenic
905307840 1:37031828-37031850 CTTGAACCCCAGCTGGAGCCAGG - Intronic
905653001 1:39668932-39668954 CTTCAGCTCCACCTGGAGCCTGG - Intronic
906180463 1:43813794-43813816 TTTTATCCTCAGATTGAGCCAGG + Intronic
906229914 1:44153306-44153328 CTTTTACACCACATGGACCCAGG + Intergenic
907273773 1:53305777-53305799 CCTCAGCCCCACAGGGAGCCAGG + Intronic
908009287 1:59759259-59759281 CTTTAACTCCACATAGAGTCAGG + Intronic
910011455 1:82468752-82468774 CTGTATCCCCACATGGTGGAAGG + Intergenic
911435091 1:97845896-97845918 CTGCAGCCTCACATGGAGCCGGG + Intronic
916013565 1:160728201-160728223 CTTTACCCCCATATGCAACCAGG - Intergenic
919266895 1:195280407-195280429 TTTTATCTCCACATGCAGCTTGG - Intergenic
1062991909 10:1827227-1827249 CTTCCTCCCAACATGGAGGCTGG - Intergenic
1066259948 10:33719853-33719875 CTTTATCCCCACATGCTGAGTGG + Intergenic
1066985992 10:42466854-42466876 CTACATCCTCACATGGAGGCAGG + Intergenic
1067998412 10:51302662-51302684 CTTTATCCTCTCTTGTAGCCTGG - Intronic
1072780451 10:98247618-98247640 CTTTTGCCTCCCATGGAGCCAGG - Intergenic
1074251852 10:111758627-111758649 CTTTATTCCCACATAAAGCCTGG + Intergenic
1076206127 10:128604779-128604801 ATTTATCCTCACATGTATCCCGG - Intergenic
1076357984 10:129866786-129866808 CCCTAGCCCCACATGGAGCCAGG + Intronic
1076595441 10:131622267-131622289 CTGTCTCCCCTCCTGGAGCCTGG - Intergenic
1076646617 10:131958573-131958595 CTTCATCCCCACAGGGGGACAGG - Intronic
1076819566 10:132931681-132931703 CTTCCTCCCCACACAGAGCCTGG + Intronic
1080209967 11:29774334-29774356 TTTTATCCACACATGTAGACTGG - Intergenic
1080855119 11:36105373-36105395 CTATATCCCTGCATGCAGCCAGG - Intronic
1088777667 11:113101031-113101053 CCTTGTCCCCAGAAGGAGCCTGG + Intronic
1091793264 12:3283447-3283469 CTTTGTCCCCACATGGGGTGGGG + Exonic
1092070878 12:5630326-5630348 CTTTATGTCCCCATGGAGCCTGG + Intronic
1092074985 12:5665583-5665605 GCTTCTCCCCACCTGGAGCCAGG + Intronic
1096884196 12:54700106-54700128 CTCTCTCCCACCATGGAGCCTGG - Intergenic
1097048312 12:56204624-56204646 CCTTACCCTCAGATGGAGCCAGG - Exonic
1097375845 12:58841399-58841421 TTTTATACCCCCATGGCGCCTGG - Intergenic
1097707555 12:62883352-62883374 ATTGATCCACTCATGGAGCCCGG - Intronic
1100618301 12:96248597-96248619 CATTTTCCACACATGGAACCTGG - Intronic
1101331176 12:103759004-103759026 CCTGATCTCCACATGGAGGCAGG + Intronic
1101443602 12:104721360-104721382 CTTTAATCCCACATGGGTCCAGG + Intronic
1102184134 12:110934558-110934580 CTGTATCCTCACAGGGGGCCAGG + Intergenic
1103783019 12:123412119-123412141 ATCTATCCCCACAGGGAGGCAGG + Exonic
1103916682 12:124379369-124379391 CTTTGTCCCCACGCTGAGCCAGG + Intronic
1104126187 12:125848377-125848399 CTCTATCTCATCATGGAGCCAGG - Intergenic
1105520600 13:21127486-21127508 CATTCTCCCTACATGCAGCCTGG + Intergenic
1106665580 13:31847167-31847189 CTTTCAACCCACATGGAGGCAGG - Intergenic
1107478538 13:40764643-40764665 CTTTATCCCTGCATGGTGGCTGG - Intronic
1109071423 13:57773743-57773765 CTGTGTCCCCACATGGGGCCAGG + Intergenic
1110136504 13:72073777-72073799 CTGTATCCTCACATGGAAGCGGG - Intergenic
1112163724 13:96895686-96895708 AGCCATCCCCACATGGAGCCAGG + Intergenic
1114307994 14:21440993-21441015 TTATCTCCCCATATGGAGCCTGG + Intronic
1116139229 14:40968434-40968456 CTTTGTCCCCAGATAGAGGCGGG + Intergenic
1117911041 14:60638178-60638200 TTTTATCCCCACATCAGGCCGGG + Intergenic
1119921477 14:78450537-78450559 CTTCCTCCCTACCTGGAGCCCGG + Intronic
1121632279 14:95430205-95430227 CTTGACACCCACATGGATCCTGG + Intronic
1123587030 15:21769930-21769952 GCTTCTCCCCACCTGGAGCCAGG - Intergenic
1123623668 15:22212495-22212517 GCTTCTCCCCACCTGGAGCCAGG - Intergenic
1124634092 15:31353900-31353922 CTTTTTCCCCAGAAGCAGCCTGG - Intronic
1126272079 15:46831728-46831750 CCTGATGCCCACATAGAGCCAGG + Intergenic
1127994652 15:64146160-64146182 CTGTATCACCACACGCAGCCTGG + Intergenic
1129063220 15:72878262-72878284 CTGTATCCTCACATGGAGGAAGG + Intergenic
1129101978 15:73273523-73273545 CTTAATCCCCACATTGAGAAGGG - Intronic
1129342783 15:74897135-74897157 CTTTCTCCCAACACGGAGTCAGG + Exonic
1131295835 15:91148408-91148430 CTGTCTCCCCACATTGAGGCTGG - Intronic
1135628592 16:24017843-24017865 CTTCATCCCCACAAGTAGCTGGG + Intronic
1135817098 16:25644433-25644455 CTTCAAACCCACATGGGGCCAGG - Intergenic
1137604534 16:49778688-49778710 CTTTCTCCCCACATCGTGACTGG - Intronic
1137862167 16:51857364-51857386 TCTTAACCCCACAGGGAGCCTGG - Intergenic
1142680709 17:1546608-1546630 CTGTACCCACACATGGAGGCTGG + Intronic
1143011644 17:3869398-3869420 CTCTGTCCCCCCAAGGAGCCAGG + Intronic
1143096369 17:4480622-4480644 CTTTAACCCCACAAAGAGCCTGG - Intronic
1143581788 17:7831845-7831867 CTTTATGCCCACCTAGAACCAGG - Intronic
1147628073 17:41912750-41912772 ATTTGTGCCCAGATGGAGCCTGG + Intronic
1149100739 17:52903552-52903574 CTCTCTCCCCACAAGTAGCCAGG + Intergenic
1152569187 17:81114078-81114100 CTTCAGCCCCCCATGGAGCTGGG + Intronic
1152583577 17:81179518-81179540 CTCCATCCCCACTTAGAGCCTGG - Intergenic
1152666701 17:81574571-81574593 CTTTATCTCCACCTGGAGCGAGG + Intronic
1153424381 18:4945920-4945942 CTTTATCCACACCTGCAGCAAGG + Intergenic
1155268110 18:24113440-24113462 CATTATCCCCACAGCCAGCCAGG - Intronic
1156570302 18:38244876-38244898 CTCTACCTCCACATGGAGCTTGG - Intergenic
1158980509 18:62756199-62756221 CATTATCCACTCAGGGAGCCAGG + Intronic
1160359964 18:78266828-78266850 TTTTATCCCAACCTGGAGGCTGG - Intergenic
1163030845 19:14543162-14543184 GCTTCTCCCCACAAGGAGCCTGG - Intronic
1163335297 19:16667389-16667411 CTCTTTCCTCACATGGAGCTTGG - Intronic
1164070611 19:21764626-21764648 TTTTTTCCCCACACGGAGTCTGG - Intronic
1164279932 19:23760201-23760223 CCCTATCTCCACATGGGGCCAGG + Intergenic
925372162 2:3354104-3354126 CTGTATCCCCACCTGGATCAAGG + Intronic
925932411 2:8719737-8719759 CTTTAACACCCCCTGGAGCCTGG + Intergenic
926707021 2:15844182-15844204 CTTGGTCCCCACATGGGGTCTGG + Intergenic
926887294 2:17609920-17609942 CTTTATCCCCACATGGAGCCCGG + Intronic
927991957 2:27454162-27454184 CTCTGTCCCCACCTGGAGGCAGG - Exonic
928217333 2:29372582-29372604 TTTAATCCTCACATGGACCCAGG + Intronic
933917389 2:87009558-87009580 CTTTGTCCTCACATGGTGTCAGG - Intronic
934005607 2:87760360-87760382 CTTTGTCCTCACATGGTGTCAGG + Intronic
935140897 2:100352007-100352029 CCTTATTCCCAGATGCAGCCCGG - Intergenic
935768563 2:106394453-106394475 CTTTGTCCTCACATGGTGTCAGG + Intronic
935838254 2:107078640-107078662 TTTAATCCACACATGGATCCTGG - Intergenic
935911539 2:107901475-107901497 CTTTGTCCTCACATGGTGTCAGG - Intergenic
935969655 2:108518329-108518351 CTTTGTCCTCACATGGTGTCAGG - Intergenic
936420517 2:112359528-112359550 CTTTGTCCTCACATGGTGTCAGG + Intergenic
938790242 2:134669909-134669931 CTTCTTCCTCACATGGTGCCTGG - Intronic
940069480 2:149669619-149669641 TTTTTTTCCCCCATGGAGCCTGG - Intergenic
943462078 2:188181513-188181535 CTTTATCCACACGTGCAGCTAGG - Intergenic
944474797 2:200092623-200092645 CAGTATCCCCACAGGAAGCCAGG + Intergenic
944556988 2:200896952-200896974 TTGTATCCCCACATTTAGCCTGG + Intronic
947068559 2:226259429-226259451 GTTTATCCCCACAGGAAACCAGG - Intergenic
1169000277 20:2163363-2163385 CTTTGTTGGCACATGGAGCCCGG + Intronic
1173460469 20:43239310-43239332 CTTTAGCTCCCCATGGAGACAGG + Intergenic
1173646441 20:44636107-44636129 CTTGATTCCCACAGGGAGACAGG + Intronic
1175301164 20:57943640-57943662 CTTTGGCCCCACATGAAGCTAGG + Intergenic
1178334226 21:31730172-31730194 CTTCCTGCCCTCATGGAGCCAGG + Intronic
1178908304 21:36654081-36654103 CTGTGTGCCCACATGGACCCAGG - Intergenic
1179879146 21:44286257-44286279 CTCCCTCCCCACAAGGAGCCAGG + Intronic
1180940681 22:19658100-19658122 CCATATATCCACATGGAGCCAGG + Intergenic
949119959 3:373466-373488 CTTTCTCCCCTGCTGGAGCCAGG - Intronic
953017785 3:39094913-39094935 CTTAATCTACACATGGAGACTGG - Exonic
954320702 3:49830371-49830393 CTTCAGCCCCATATAGAGCCTGG - Intronic
954453296 3:50583320-50583342 CTTTACCCCCACCTGGACCCTGG + Exonic
954962485 3:54578589-54578611 CTGTATCACCAGAGGGAGCCGGG - Intronic
955287822 3:57660590-57660612 CTTCAGCCCCACAAGTAGCCAGG - Intronic
957472119 3:80671232-80671254 CTTTATCCCCACATGTAAGCTGG - Intergenic
959781755 3:110242244-110242266 CTATAGCCCCATATGGAGACTGG - Intergenic
961006519 3:123409365-123409387 CTTTTTCCCCACATGCTACCTGG - Intronic
962480620 3:135795104-135795126 CTTTATCACCAAATGGATACAGG + Intergenic
964626294 3:158763371-158763393 CTTTTTGCCCTCTTGGAGCCTGG + Intronic
971742700 4:30540318-30540340 CTTCATCTCCTCCTGGAGCCTGG + Intergenic
972282677 4:37618333-37618355 CTTTATCCTCCCATGTAGCTGGG + Intronic
974610148 4:64206292-64206314 GTTTATCTGCCCATGGAGCCTGG + Intergenic
976399924 4:84596059-84596081 CTCTATCCCCAAATGGAATCGGG - Intronic
976929811 4:90552007-90552029 CTGTGTCCCCACATGGAGAAAGG + Intronic
977693464 4:99942651-99942673 CTTAATCCCCAAATGGATCTAGG - Intronic
979978359 4:127224653-127224675 CTTTTTCCCCTGCTGGAGCCAGG - Intergenic
982014077 4:151135541-151135563 CTTTAGCCCCACAAGTAGCTGGG + Intronic
989401175 5:41009204-41009226 ATCTATCCCCACCTGGAGCTTGG - Intronic
989719102 5:44503877-44503899 GTTCATCTCCTCATGGAGCCAGG - Intergenic
990215841 5:53530908-53530930 CTTCATCCCCAAATGGAGGCAGG - Intergenic
990863631 5:60355980-60356002 CTTTATCCCTACATCTAGTCTGG + Intronic
992084250 5:73263835-73263857 CTTCATCCCATCATGGAGCCTGG + Intergenic
992388016 5:76304445-76304467 CTTCATCTCCCCATGGAGGCAGG + Intronic
992790355 5:80208098-80208120 CTTTATGCCCTCTTGGAGCCAGG - Intronic
995402724 5:111759885-111759907 CTTTATCCCGTAATGGAGCAGGG - Intronic
998576352 5:143321688-143321710 CTTTATCACTACAGGGATCCTGG + Intronic
999269282 5:150286969-150286991 CTTTACCCCCACCTGTAGTCTGG - Intronic
999897848 5:156053885-156053907 CTTTGTCCCCACATGGTGGAAGG + Intronic
1001051725 5:168419356-168419378 CTTTTTCTCCAGATGAAGCCAGG - Intronic
1001456955 5:171870419-171870441 CTTTATCCCTAAATTAAGCCAGG - Intronic
1001993490 5:176135375-176135397 CTGTATCCCCCCATGGTGTCAGG - Intergenic
1007089088 6:39170752-39170774 CTGTAACCCCACCTGGAGCTTGG - Intergenic
1007613788 6:43168298-43168320 CTTTGTCACCACAGGGAGTCAGG - Intergenic
1010934550 6:81845755-81845777 CTATATCCCCACTGGAAGCCAGG - Intergenic
1015135767 6:129868222-129868244 ATTTTTCCCCAGTTGGAGCCTGG - Intergenic
1015791687 6:136969795-136969817 CTTTTCCCCAAGATGGAGCCTGG - Intergenic
1018706676 6:166468551-166468573 CTTTATGTCCTCATGGAGTCCGG - Intronic
1019557219 7:1638621-1638643 CTTTATCCGCAACTGGAGCGAGG - Intergenic
1020070822 7:5225973-5225995 CTTTGTCCCCACTTGCTGCCGGG + Intronic
1021973033 7:25984042-25984064 CCTTTGCCCCACCTGGAGCCTGG + Intergenic
1023017382 7:35981715-35981737 CCTTTTCCCCACATGCAGGCAGG + Intergenic
1023117603 7:36877386-36877408 TTTTAGCCCCACAGGGAACCAGG - Intronic
1026401650 7:70020305-70020327 CTGCATCCCCACATAGAGCCAGG + Intronic
1028504633 7:91557570-91557592 CTTTTTCCCCACAACAAGCCAGG + Intergenic
1032340421 7:131067322-131067344 CATCATCGCCACATGGAGCGGGG - Intergenic
1035455042 7:159002735-159002757 CTTGATTCCCTCATGGAACCAGG + Intergenic
1036911754 8:12763376-12763398 CTGTATCCCCACATGGAAGAAGG + Intergenic
1037419354 8:18685885-18685907 CTTTATCCCCACACAGAGGCAGG - Intronic
1040835059 8:51722752-51722774 GTTTGTCCCCTCATGGAGCCTGG + Intronic
1041195977 8:55401668-55401690 CTTTGGCCCCAGATGGACCCAGG - Intronic
1042199812 8:66270307-66270329 CTTGCTGCCCTCATGGAGCCTGG - Intergenic
1047721162 8:127641006-127641028 CTGTCTCCCCAGATGGAGCATGG - Intergenic
1047988634 8:130262637-130262659 CTTTATCCCAACATGGATCATGG - Intronic
1056230501 9:84538525-84538547 CTCTAGACCCACCTGGAGCCAGG - Intergenic
1058237137 9:102504016-102504038 CTTTACCCTCACCTGGACCCTGG - Intergenic
1058981084 9:110171306-110171328 CCTTATCCACACACGGAGCATGG - Exonic
1060881993 9:127123807-127123829 CTGTATCCCCGCAGGGTGCCCGG - Intronic
1062276588 9:135734209-135734231 CTTTCTGCTCCCATGGAGCCTGG - Intronic
1186583784 X:10849788-10849810 CATTTTCCCCACTTGGTGCCTGG - Intergenic
1192185911 X:68946755-68946777 CTTTCTCCCAACATGGAGGCAGG - Intergenic
1198028857 X:132735655-132735677 CTGGATGCCCACATGGAGCTGGG + Intronic
1199978123 X:152906078-152906100 CTTTCTCCCCTCATGGTGTCTGG - Intergenic
1200878529 Y:8185531-8185553 CTCGATCCCCTCATGGAGGCTGG - Intergenic