ID: 926887645

View in Genome Browser
Species Human (GRCh38)
Location 2:17612726-17612748
Sequence GTTAAAGCCCAGAGGCAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 145}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926887645_926887651 -2 Left 926887645 2:17612726-17612748 CCAGGTTGCCTCTGGGCTTTAAC 0: 1
1: 0
2: 0
3: 12
4: 145
Right 926887651 2:17612747-17612769 ACATGTTGCTGGAAGGGGACAGG 0: 1
1: 0
2: 1
3: 17
4: 191
926887645_926887650 -7 Left 926887645 2:17612726-17612748 CCAGGTTGCCTCTGGGCTTTAAC 0: 1
1: 0
2: 0
3: 12
4: 145
Right 926887650 2:17612742-17612764 CTTTAACATGTTGCTGGAAGGGG 0: 1
1: 0
2: 1
3: 16
4: 218
926887645_926887649 -8 Left 926887645 2:17612726-17612748 CCAGGTTGCCTCTGGGCTTTAAC 0: 1
1: 0
2: 0
3: 12
4: 145
Right 926887649 2:17612741-17612763 GCTTTAACATGTTGCTGGAAGGG 0: 1
1: 0
2: 0
3: 12
4: 153
926887645_926887648 -9 Left 926887645 2:17612726-17612748 CCAGGTTGCCTCTGGGCTTTAAC 0: 1
1: 0
2: 0
3: 12
4: 145
Right 926887648 2:17612740-17612762 GGCTTTAACATGTTGCTGGAAGG 0: 1
1: 0
2: 0
3: 17
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926887645 Original CRISPR GTTAAAGCCCAGAGGCAACC TGG (reversed) Intronic
900732500 1:4271492-4271514 GTGCCAGCCCAGAGGCAATCAGG - Intergenic
900958820 1:5906402-5906424 GTTTCAGCCCAGAGGAAACCAGG + Intronic
902735317 1:18396914-18396936 GGTGAAGTCCAGAGGAAACCAGG - Intergenic
903415532 1:23179993-23180015 GTCAAAGCAAAGAGGGAACCAGG + Intergenic
904317270 1:29673615-29673637 GTTAAAGCCCAGTGGCCAGTGGG + Intergenic
905261830 1:36724802-36724824 GCATCAGCCCAGAGGCAACCTGG - Intergenic
905400308 1:37697328-37697350 GACAAAGTCCAGAGGAAACCAGG + Intronic
906509853 1:46404789-46404811 GTTGAAGGCCAGAGACAGCCAGG + Intronic
907038144 1:51234981-51235003 GATAGAGCCCAGAGACCACCTGG - Intergenic
912525485 1:110279768-110279790 CCTAAAGCCCACAGGGAACCAGG - Intronic
912829331 1:112937704-112937726 GCTAAAGCCCAGAGGCTAAAAGG + Intronic
915993280 1:160539101-160539123 GGCAAAGTCCAGAGGAAACCAGG + Intergenic
916482479 1:165227240-165227262 TTTAAAACACAGAGCCAACCAGG + Intronic
917590134 1:176468203-176468225 GTCAGAGCCCAGAGACATCCAGG - Intronic
918991947 1:191708170-191708192 GGTAAAGTTCAGAGGAAACCAGG + Intergenic
920674519 1:208029881-208029903 GTTAAAGCCCAGAAGGCAGCTGG - Intronic
923815486 1:237373248-237373270 GTTATAGCCAAGAGGCTCCCAGG - Intronic
1063802634 10:9597574-9597596 GTTAGACCCCAGTGGCAACCAGG - Intergenic
1065677366 10:28192040-28192062 CTTGAACCCCAGAGGCAGCCTGG + Intronic
1067300846 10:45007799-45007821 CTTAAATCCCAGAGAGAACCTGG + Intergenic
1067547395 10:47203672-47203694 GTTACAGCCCAGATGTACCCTGG - Intergenic
1068516238 10:58028957-58028979 GGCAAAGTCCAGAGGAAACCAGG + Intergenic
1069554008 10:69384857-69384879 CGTGAAGCCCAGAGGCATCCTGG - Exonic
1072313000 10:94174778-94174800 GTTAAAGGCTAGAGGAGACCAGG + Intronic
1072655539 10:97327701-97327723 GTTAAAGCTCCCAGGCACCCAGG + Intergenic
1072719707 10:97772884-97772906 GTCAGAGCCCAGAAACAACCAGG + Intergenic
1076212740 10:128661879-128661901 GCAAAAGCCCAGAGGCTAGCTGG - Intergenic
1078194530 11:9124619-9124641 GTCATAGCTCAGAGGCACCCAGG + Intronic
1078365886 11:10706020-10706042 GTTAATGCCCTGAGGAAGCCAGG + Intergenic
1078961144 11:16273618-16273640 GATAAGGCAAAGAGGCAACCAGG + Intronic
1080730051 11:34941187-34941209 GCCAAAGACCTGAGGCAACCTGG - Intronic
1080852353 11:36080757-36080779 AATAAAGTCCAGAGGAAACCAGG + Intronic
1081591229 11:44424698-44424720 GCAAAAGCCCCGAGGCACCCCGG + Intergenic
1081816445 11:45946344-45946366 GTCAAAGCCCAGTGGGAGCCAGG + Intronic
1087509198 11:99068594-99068616 CTTAAAGCCCTTAGGAAACCAGG + Intronic
1089455332 11:118622458-118622480 TTTATAGCCCAGAGGCAGCATGG + Intronic
1092630297 12:10369603-10369625 CTTAAGGCCTAAAGGCAACCCGG + Intergenic
1098077727 12:66750612-66750634 GTTTAATCCCAGAGGCAACAGGG + Intronic
1098795628 12:74885323-74885345 GTTGAAGCCCAAAGGCAAATTGG + Intergenic
1101000833 12:100355999-100356021 AGTAAAGCCCAGAGGCAATAGGG + Intergenic
1101884013 12:108645983-108646005 GTCAAAGCACAGAGGCTCCCCGG - Exonic
1105402251 13:20105913-20105935 GCTAACACCCAGAGGCAAACAGG - Intergenic
1107099258 13:36571610-36571632 GTCACAGCCCTGAGGCAACAGGG - Intergenic
1107789349 13:43985926-43985948 GGTCAAGGTCAGAGGCAACCTGG - Intergenic
1110709689 13:78636610-78636632 CCTAGAGCCCAGAGGGAACCTGG - Intronic
1114764017 14:25350095-25350117 TTTAAAGCCAAGAGGCAGCAGGG - Intergenic
1117034893 14:51717995-51718017 GTAAAAGCCCAGAGACAATGAGG - Intronic
1117444857 14:55794404-55794426 GGTAAAGACCAGAGGGAACCAGG + Intergenic
1119333628 14:73814349-73814371 GTGAAAGCCCAGGGGAAGCCTGG - Intergenic
1119766935 14:77196175-77196197 ATTACAGCCCAGAGGCCACGTGG + Intronic
1122183206 14:99970926-99970948 TTTAAAAACCAGAGACAACCTGG + Intergenic
1123458513 15:20446782-20446804 GGTAAAGTCCAGAGGAAAGCAGG - Intergenic
1123659550 15:22553627-22553649 GGTAAAGTCCAGAGGAAAGCAGG + Intergenic
1124264803 15:28222951-28222973 GGTAAAGTCCAGAGGAAAGCAGG - Intronic
1124313411 15:28648122-28648144 GGTAAAGTCCAGAGGAAAGCAGG + Intergenic
1128861464 15:71077693-71077715 GCACAAGCCCAGAAGCAACCTGG - Intergenic
1129192435 15:73945347-73945369 GTTAGAGCTCACAGGCAATCCGG + Intronic
1130866866 15:87940601-87940623 GGTAAACCCCAGAGGCATGCCGG - Exonic
1132289058 15:100686577-100686599 GTCAAGGCCCAGAGGGAAGCGGG + Intergenic
1132739902 16:1406633-1406655 TTTAAAACTCAGAGGCATCCGGG - Intronic
1135539642 16:23320273-23320295 GTTAAAACCCAGAGGCCTCGGGG + Intronic
1136588575 16:31202988-31203010 GTGCAAGCCCAGAGACAAGCAGG - Exonic
1137039571 16:35598098-35598120 CTTAAGGCCCAAAGGCAGCCAGG - Intergenic
1141312499 16:82928290-82928312 GTGAAAACCTAGAGGCAACCTGG - Intronic
1143266531 17:5642176-5642198 GTTAAAGAGCAGAAGCAAGCTGG + Intergenic
1143619876 17:8074673-8074695 GTTAAGGGCCAGAGGGATCCAGG - Intronic
1148073061 17:44919889-44919911 GGTAAAGCCCAGATGCCTCCTGG + Intergenic
1153696314 18:7646341-7646363 ATCAAAGCCCAGAGGCAATGAGG - Intronic
1155527712 18:26734033-26734055 TTTAAACTCCAGATGCAACCAGG - Intergenic
1156910578 18:42407288-42407310 GTTAATGCCCAGAAGCAAGATGG + Intergenic
1157149333 18:45200019-45200041 GTTAAAGCCCCATGGCCACCAGG - Intergenic
1157871297 18:51232341-51232363 GTTAGAGTACAGAGGCAAACAGG + Intergenic
1162363227 19:10231630-10231652 GGGTAAGCCCAGAGGTAACCTGG - Intergenic
1162963398 19:14142512-14142534 GCTGAAGTCCAGAGGAAACCAGG - Intergenic
1163428334 19:17251494-17251516 GCTAAGGCCCAGAGACAGCCAGG + Intronic
1164486500 19:28660434-28660456 TTTAAACCCCAGGGGCAACTAGG + Intergenic
1166210384 19:41302989-41303011 GTCAAAGCCCAGCCCCAACCTGG - Intronic
925273711 2:2634239-2634261 GGTAAAACCGAGAGGCATCCGGG - Intergenic
925375249 2:3379601-3379623 GTGAACGCGCACAGGCAACCAGG - Intergenic
926887645 2:17612726-17612748 GTTAAAGCCCAGAGGCAACCTGG - Intronic
930723809 2:54663595-54663617 GAGAAAGCCCAGAGACAGCCAGG - Intronic
931969571 2:67570946-67570968 GTTAAAACCCAGTCACAACCTGG + Intergenic
932520948 2:72411698-72411720 GTAAAACCCCTGAGACAACCAGG + Intronic
932747980 2:74350435-74350457 CTTAAAGCCCAGATCCAACCTGG - Intronic
932837322 2:75049705-75049727 CTTGAAGCCCAGACGGAACCTGG + Exonic
933622761 2:84562668-84562690 GATAAAGTTCAGAGGAAACCAGG + Intronic
935561890 2:104568109-104568131 GGTCAAGCCCTGAGGCAACGTGG + Intergenic
939488973 2:142854082-142854104 CTTTAAGCCCCGGGGCAACCAGG + Intergenic
940373188 2:152924224-152924246 GTTAATGACCAGAGGCACCCTGG - Intergenic
941274407 2:163472486-163472508 ATTAAAGACCAGAGTCAACATGG - Intergenic
943374904 2:187064583-187064605 GTTCAAGCTCAAAAGCAACCTGG - Intergenic
945345800 2:208714492-208714514 GATAAATCCTAGAGGCTACCAGG - Intronic
948665441 2:239531910-239531932 GTCAAAGGCCAGAGCCAGCCTGG + Intergenic
1169275656 20:4232207-4232229 GTGAAAACCCAGAGGCTGCCGGG - Intronic
1171142886 20:22758303-22758325 GTTCACACCCAGAGCCAACCTGG - Intergenic
1173993733 20:47322183-47322205 ATGAAAGCCCAGAGAAAACCAGG + Intronic
1174116661 20:48230982-48231004 GGTGCAGCCCACAGGCAACCTGG - Intergenic
1182859136 22:33544165-33544187 GGTGAAGTCCAGAGGAAACCAGG - Intronic
1184087667 22:42274861-42274883 GATACAGCCCAGAGGAATCCAGG + Intronic
1185235527 22:49710562-49710584 CTTAAAGCCCAAATGCAATCAGG + Intergenic
1185269105 22:49920317-49920339 GTAAAAGCACAGAGGGGACCTGG + Intronic
949868361 3:8565699-8565721 GTAAAAGCCCAGAGGCCAAGAGG + Intronic
950577333 3:13840100-13840122 GTCAGAGCCCAGAGGCAAAGAGG - Intronic
950846144 3:16017790-16017812 GATAAAGACCAGGGTCAACCAGG - Intergenic
951243187 3:20310834-20310856 GTCAAAGCCCAGAGCCACCCTGG - Intergenic
952771902 3:37009229-37009251 GTTAAGTCCCAGAGGCACCCTGG - Intronic
953079299 3:39600479-39600501 TTTAATTCCCAGAGGCAACCTGG + Intergenic
953682244 3:45048393-45048415 GTCACTGCCCAGAGGCAGCCGGG - Intergenic
954128453 3:48546961-48546983 GGTGAAGTCCAGAGGAAACCAGG - Intronic
960219388 3:115087048-115087070 GTTCAAGCACAGAGGCTAACTGG + Intronic
960691021 3:120347031-120347053 GGGAAAGCCCAGAGGCAAGGAGG - Intronic
961584468 3:127910857-127910879 GTTGAAGCCCCCAGGCCACCAGG + Intergenic
964427989 3:156573233-156573255 GTTAAAGCCTAGAGGGTCCCAGG - Intergenic
967072042 3:185970963-185970985 TTTGAAGCCAAGAAGCAACCTGG - Intergenic
968517238 4:1020582-1020604 CTTCCAGCCCAGAGGCACCCAGG + Intronic
968607805 4:1543751-1543773 GGAAAAGTCCACAGGCAACCTGG + Intergenic
968958664 4:3731630-3731652 GGTGAAGTCCAGAGGCAAGCTGG + Intergenic
969856864 4:10007029-10007051 GGTGAAGTCCAGAGGAAACCAGG - Intronic
971530726 4:27685253-27685275 GTCAGAGACCAGAGGCAGCCTGG + Intergenic
971970019 4:33607622-33607644 GTGAAAGCCTACAGGCAAGCAGG + Intergenic
985617998 5:936214-936236 CTCTAAGCCCAGAGGCAGCCTGG + Intergenic
989178381 5:38552771-38552793 GTCAAAGGCCAGAGCCAAGCTGG + Intronic
994203052 5:97000701-97000723 GACAAAGTCCAGAGGAAACCAGG - Intronic
995752549 5:115469481-115469503 CTTAAAAACAAGAGGCAACCAGG - Intergenic
996581599 5:125037661-125037683 GGTGAGGCCCAGAGGAAACCAGG - Intergenic
996862464 5:128082934-128082956 GTCAGAGCCCAGAGCAAACCAGG + Intergenic
999622237 5:153485286-153485308 GTTAGAGTCCAGAGTCATCCTGG - Intergenic
1000884433 5:166735201-166735223 CTTAAAGCCCACAGGCAGGCAGG + Intergenic
1001313214 5:170625728-170625750 GTCAAAACCCAGAGGCAGCAGGG + Intronic
1003081265 6:3023661-3023683 GGTAACGACCAGAGGCAAACCGG + Intergenic
1008863505 6:56181003-56181025 GATAAAGCCGACAGGCAATCAGG - Intronic
1011454462 6:87532609-87532631 GGTAAAGTCCAGAGGAAACCAGG - Intronic
1011688549 6:89844420-89844442 GGTAAAGTCTAGAGGAAACCAGG + Intronic
1013398021 6:109762952-109762974 GGCAAAGTCCAGAGGAAACCAGG + Intronic
1015198250 6:130548136-130548158 GATAAAGCCAAGAGGCAATAAGG - Intergenic
1016514646 6:144880594-144880616 TTTAAAGACCTGTGGCAACCTGG - Intergenic
1019279873 7:194143-194165 CTGAAAGCCCAGCGGCAGCCTGG - Intronic
1019436868 7:1026849-1026871 GATGAAGCCCAGAGGCTGCCTGG - Intronic
1019881984 7:3869490-3869512 GTGCAAGCCCAGAGGGAAGCAGG + Intronic
1022389237 7:29929018-29929040 GTCAGAGCCCAGAGGTAGCCTGG - Intronic
1023041716 7:36178520-36178542 GTTAAAGCCCATATGAAATCTGG - Intronic
1028728916 7:94122321-94122343 GATAAAGCCAAGAGGCAACTGGG - Intergenic
1036779269 8:11634545-11634567 GTTAATGGGCAGTGGCAACCAGG + Intergenic
1045050245 8:98318015-98318037 GTTTAAAACCAGAGGTAACCAGG + Intergenic
1045749197 8:105461397-105461419 GTAAAAGCCCAAAGGAAATCAGG - Intronic
1048833115 8:138495775-138495797 GTCAAAGCCGAGAGGCACCTGGG - Intronic
1050209886 9:3241418-3241440 GTTATAGCCCAGAGCCAGCAGGG + Intronic
1052831583 9:33220495-33220517 GTTAACTCCAAGAGTCAACCAGG - Intronic
1055397110 9:75888021-75888043 TTTGAAGCCCAGAGACAACAAGG + Intergenic
1060259923 9:122065383-122065405 GTAAAAACCCATAGGAAACCCGG - Intronic
1061468822 9:130806137-130806159 GTCAAAGACCAGATGCCACCAGG + Intronic
1062327488 9:136019194-136019216 GTTAAAGCCCAGTTGTAGCCTGG - Intronic
1062436698 9:136549545-136549567 GCTCAAGCCCAGAGGCCTCCAGG + Intergenic
1194239980 X:91434188-91434210 GCTAAAGGCCAAAGGCAACATGG + Intergenic
1196206178 X:112942548-112942570 GTTAAAGCCCTGTGACAATCTGG - Intergenic
1197375737 X:125680159-125680181 GTTCAAGCCCAAAGGCACTCAGG + Intergenic
1198791815 X:140354570-140354592 TTTAAAGCCTAGAGGAACCCCGG - Intergenic
1199637968 X:149831567-149831589 CTTAAGGCCCAAAGGCAGCCAGG + Intergenic