ID: 926888317

View in Genome Browser
Species Human (GRCh38)
Location 2:17617715-17617737
Sequence GGAGGCAGCAAGTGGAAGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 512
Summary {0: 1, 1: 0, 2: 4, 3: 46, 4: 461}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926888313_926888317 6 Left 926888313 2:17617686-17617708 CCGCATCACACAGTGAGGAGCAA 0: 1
1: 0
2: 2
3: 21
4: 219
Right 926888317 2:17617715-17617737 GGAGGCAGCAAGTGGAAGTAAGG 0: 1
1: 0
2: 4
3: 46
4: 461
926888311_926888317 24 Left 926888311 2:17617668-17617690 CCGAGAGCTGGGTGGTGACCGCA 0: 1
1: 0
2: 0
3: 9
4: 136
Right 926888317 2:17617715-17617737 GGAGGCAGCAAGTGGAAGTAAGG 0: 1
1: 0
2: 4
3: 46
4: 461

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926888317 Original CRISPR GGAGGCAGCAAGTGGAAGTA AGG Intronic
900371521 1:2334238-2334260 GGGGGCAGCAGGTGTAAGAACGG + Intronic
900471972 1:2859517-2859539 GGAGGGAGGAAGAGGAAGGAAGG + Intergenic
900471982 1:2859549-2859571 GGAGGGAGGAAGAGGAAGGAAGG + Intergenic
900745656 1:4359099-4359121 GGAGGCTGCAAGAGGCAGGAAGG + Intergenic
900862971 1:5246129-5246151 GGAGGGAGGAAGAGGAAGGAAGG - Intergenic
900862980 1:5246155-5246177 GGAGGGAGGAAGAGGAAGGAAGG - Intergenic
900862989 1:5246181-5246203 GGAGGGAGGAAGAGGAAGGAAGG - Intergenic
901135963 1:6995784-6995806 GGAGGGAGCAAGGAGAAGTATGG + Intronic
901812303 1:11774857-11774879 GGAGGCCGAAAGTGGATGCAGGG + Intronic
901923688 1:12552938-12552960 GGAGGACGCAGGTGGAAGCAGGG - Intergenic
902683328 1:18059034-18059056 GGAGGCAGGGCGTGGAAGGATGG - Intergenic
902745486 1:18470942-18470964 GGAGCCAGCAAGTGGCAGATCGG + Intergenic
902754440 1:18539990-18540012 GGAGGAAGGAAGGGGAAGGAAGG + Intergenic
903122313 1:21224344-21224366 GGAGGCTGGAAGGGGAAGAAAGG - Intronic
903653050 1:24932676-24932698 GGAGGAAGCAGGTGGAAATTGGG - Intronic
904408187 1:30307429-30307451 GGAGGTAGCTAATGGAAATAAGG + Intergenic
904675123 1:32194360-32194382 GAAGGGAGCAAATGGAAGAAAGG + Intronic
905973853 1:42161712-42161734 GGAGGCAGGGTGTGGAAGTGAGG - Intergenic
908304652 1:62799948-62799970 GGAGGCAGAGAGTGGAAGGATGG - Intronic
908590663 1:65629620-65629642 GGAGGGAGGAAGAGGAAGGAAGG - Intronic
908718112 1:67091669-67091691 CCAGGCAGCAACTGGAAGCAAGG + Intergenic
909685151 1:78339560-78339582 GGAGGCAAAAACTGGAATTAGGG - Intronic
911188106 1:94923947-94923969 GAAGGCAGGAAGTGGCAGAACGG + Intronic
912591405 1:110824499-110824521 GAAGGCTGCAGGTGGATGTATGG + Intergenic
913586995 1:120285396-120285418 GAAGACAGAAAGTGGAACTATGG + Intergenic
913588697 1:120301929-120301951 GGAGTAAGCAACTGGAAGGATGG + Intergenic
913619488 1:120596440-120596462 GGAGTAAGCAACTGGAAGGATGG - Intergenic
913621190 1:120612974-120612996 GAAGACAGAAAGTGGAACTATGG - Intergenic
914569009 1:148897281-148897303 GAAGACAGAAAGTGGAACTATGG + Intronic
914570720 1:148913800-148913822 GGAGTAAGCAACTGGAAGGATGG + Intronic
914602110 1:149216463-149216485 GGAGTAAGCAACTGGAAGGATGG - Intergenic
914603818 1:149232975-149232997 GAAGACAGAAAGTGGAACTATGG - Intergenic
914919205 1:151836336-151836358 GGAGGCAGCAGCTGGCAGTGGGG + Intergenic
915037464 1:152941059-152941081 TGAGGCAGCAACTGGATATATGG + Intergenic
915791111 1:158672432-158672454 AGAGCCAGGAAGTAGAAGTATGG + Intronic
916899661 1:169207184-169207206 GGTGGAAGCAAGAGGAAGAAGGG + Intronic
917096400 1:171403287-171403309 GAAGGCAGCCAGAGGAATTAGGG + Intergenic
917702731 1:177597410-177597432 GGTGGCAGGAAGGGGAAGTAAGG + Intergenic
918119536 1:181526066-181526088 GGAGGCAGGGAGGGGAAGAATGG + Intronic
918639234 1:186818582-186818604 AGAGACAGCAAATGGAAGTTTGG + Intergenic
918645777 1:186902805-186902827 GGAGTCAGCAAGGGGAGATAGGG - Intronic
919947182 1:202328227-202328249 GGAGGAAGACAGTGGAAGGAAGG + Intergenic
921919884 1:220655881-220655903 GGAAGCAGCAAGGGGAAGAGTGG - Intronic
923173915 1:231445222-231445244 GAAGGCAGCCAGTGGAATTGGGG + Intergenic
1063152994 10:3353762-3353784 GGAGACAGAAAGTGGAAGGGGGG - Intergenic
1064563338 10:16614354-16614376 GGAGGCTGGAAGGGGTAGTAGGG + Intronic
1065450605 10:25852556-25852578 GGAGGCAGCCAGGGGATGCAAGG + Intergenic
1067047033 10:42990678-42990700 GGAGGCAGCCAGGGGAAGATGGG + Intergenic
1067261966 10:44700584-44700606 GGAGGAGGCAGGAGGAAGTATGG + Intergenic
1067819785 10:49518569-49518591 GGTGGCATCAAGTGGAGGTGGGG - Intronic
1068533073 10:58210536-58210558 GAAGGCAGCCAGCGGAATTAGGG - Intronic
1068590393 10:58846944-58846966 AGAGTCAGGAAGTGGAAGGATGG + Intergenic
1069145302 10:64885512-64885534 GGAGATAGAAAGTGGAAGGATGG - Intergenic
1069216551 10:65828455-65828477 GGTGGCAGCAAGAGAAAGTGTGG - Intergenic
1069723552 10:70563964-70563986 GTTGGCAGGAAGTGGCAGTAAGG + Intronic
1069861199 10:71472712-71472734 GGTGGCAGCAAGTGGTGGGAGGG + Intronic
1069896686 10:71684442-71684464 GGAGACACCAAGTGGAAAGAGGG + Intronic
1070078859 10:73165993-73166015 GGAGATAGCAAGTAGAAGGATGG - Intronic
1070331842 10:75423100-75423122 TGAGGCAGCAAGTGCACGTCGGG - Intergenic
1070739810 10:78895415-78895437 GAAGGAAGGAAGTGGAAGGAAGG + Intergenic
1071899848 10:90108401-90108423 GGAGGCAGAAATTGGACATAAGG + Intergenic
1071970231 10:90898105-90898127 GGAGACAGAAAGTAGAAGGATGG - Intronic
1071992456 10:91113247-91113269 GGAGGCAGTAAGTGTAACTGTGG + Intergenic
1072264773 10:93716669-93716691 GGTGGGAGCAGGAGGAAGTAGGG + Intergenic
1072313069 10:94175746-94175768 GGAGACAGAAAGTAGAAGGATGG - Intronic
1072728527 10:97829513-97829535 GGAGGCAGGAAATGAAAGTGGGG - Intergenic
1072814622 10:98493007-98493029 AGAGGCAGAAAGTGGAACGATGG - Intronic
1072871577 10:99125876-99125898 GAAGGCAGCAAGTAGAATTAGGG + Intronic
1073773350 10:106759726-106759748 GGGGGCAGCAAGAGAAAGAAAGG - Intronic
1074471927 10:113735211-113735233 GGAGGCAGAAAGAGCAAGTGAGG - Intergenic
1074680676 10:115903996-115904018 GGAGGAAGCATGAGTAAGTAAGG + Intronic
1074975837 10:118580954-118580976 GGAGGCAGCACGGGGTAGTGGGG + Intergenic
1075153176 10:119953514-119953536 GGAGGGAGGAAGAGGAAGGAAGG - Intergenic
1075153196 10:119953577-119953599 GGAGGGAGGAAGAGGAAGGAAGG - Intergenic
1075153216 10:119953640-119953662 GGAGGGAGGAAGAGGAAGGAAGG - Intergenic
1075243778 10:120801877-120801899 AGTGGCAGCCAGTGGATGTATGG - Intergenic
1075443734 10:122499361-122499383 AGAGACAGCATGTGGAAGAAAGG + Intronic
1075938491 10:126365604-126365626 GGAGGCAGGAAGGAGAAGTGTGG + Intronic
1076525432 10:131109714-131109736 GGAGGCTGAGAGTGGAAGAAAGG - Intronic
1077251923 11:1564530-1564552 GGAGGCAGCAGCTGGAAGCTGGG + Intronic
1077525807 11:3063913-3063935 GGTGGCAGCAAGAGAAAATAAGG - Intergenic
1077681046 11:4240239-4240261 GCAGGAGGCAAGTGGAAGTGGGG - Intergenic
1077685331 11:4285681-4285703 GCAGGAGGCAAGTGGAAGTGGGG - Intergenic
1077689852 11:4332248-4332270 GCAGGAGGCAAGTGGAAGTGGGG + Intergenic
1078169044 11:8914598-8914620 GGAGGCAGCAGGTGGCAGCACGG + Intronic
1078253698 11:9639343-9639365 AGAGGCACCAAGGGGAAGCAAGG - Intergenic
1078608384 11:12797581-12797603 GGAGTCAGGAAGAGGAAGAAAGG - Intronic
1078991160 11:16647916-16647938 GAAGGCAGCCAGTGGAATTGTGG + Intronic
1079504611 11:21139449-21139471 GGAGAAAGCAAGTGACAGTAGGG - Intronic
1079985969 11:27201353-27201375 GGAGGCAGGAAGTGGTAGAGAGG - Intergenic
1081436050 11:43028469-43028491 TGAAGAAGCAAGTGGAAGGAGGG - Intergenic
1082544716 11:54311543-54311565 GGAGTCTGCAAGTGGATGTTTGG + Intergenic
1083616364 11:64028469-64028491 GGAGGCAGGAGGCGGAAGGAAGG + Intronic
1084220448 11:67674481-67674503 GGAGGCAGCATGTCCAAGAAAGG - Exonic
1084415649 11:69031479-69031501 GGCGCCTGCAAGTGGAAGGAAGG + Intergenic
1084632402 11:70362263-70362285 GGAGGCGGAAAGCGGAAGGAAGG - Intronic
1085855838 11:80174702-80174724 AGAGGCAGAAAGAGGAAGGAAGG + Intergenic
1088121879 11:106379527-106379549 TGAGGCAGAAAGTGGGAGTGGGG - Intergenic
1088187725 11:107191709-107191731 GAAGGCAGCAAGAGGAAGAAAGG - Intergenic
1089871067 11:121673034-121673056 GCAGGCAGCAAGCGGGAGAAGGG + Intergenic
1089884642 11:121808061-121808083 GGATTCAACAAGTGAAAGTAAGG - Intergenic
1090088362 11:123671516-123671538 GGAGTCAGAAAGTGGAAATCGGG - Intergenic
1090756630 11:129797672-129797694 GAAGGCAGCCAGTGGAATTGGGG + Intergenic
1090931267 11:131300022-131300044 GGAGGCAGAAAGAAGAAGAAGGG + Intergenic
1091430864 12:433119-433141 GTATGAAGTAAGTGGAAGTAGGG + Intronic
1091666472 12:2422406-2422428 GGAGGCACCAAGGGGAAAGAAGG - Intronic
1091683087 12:2540746-2540768 GGAGCCAGCACGTTGAAGGATGG + Intronic
1091851255 12:3698950-3698972 GGGAGCAGCAGGTGGGAGTAGGG - Intronic
1092023198 12:5219405-5219427 GGAGGCAGCAAGTGTATGCAGGG - Intergenic
1092889590 12:12956282-12956304 GGAGGAAGGAAGGGGAAGGAAGG - Intergenic
1093072910 12:14724986-14725008 GGAGTCAGCAAAGGGAGGTAGGG + Intergenic
1093435039 12:19127032-19127054 GGAGGCAGTAACTAGAAATATGG - Intergenic
1094131755 12:27082317-27082339 GGAGGCAGAAAGTGGATGGAAGG + Exonic
1094181154 12:27593873-27593895 GGAGGGAGAAAGTGGATGGAAGG + Intronic
1094706213 12:32916464-32916486 GGAGGCAGCAAGAGAAAATGAGG - Intergenic
1095173312 12:39060576-39060598 GGAGTCAGCAAAGGGATGTAGGG - Intergenic
1096037091 12:48482002-48482024 GGAGGCAGGAAGTGAAAATTAGG - Intergenic
1098050393 12:66446793-66446815 GCTGGCAGAGAGTGGAAGTAGGG - Intronic
1099039051 12:77627975-77627997 GGAGGTAGAAAGTGGAATAATGG + Intergenic
1100728766 12:97440536-97440558 GGAAGCAGCCTGTGGCAGTATGG + Intergenic
1101254698 12:102965667-102965689 CGAAGCAGGAAGTGGATGTAGGG + Intergenic
1101461012 12:104893820-104893842 GGAGACAGAAAGTAGAAGGATGG + Intronic
1102245574 12:111353666-111353688 GGAGGCTGGAAGTTGAGGTAGGG + Intergenic
1103176844 12:118871734-118871756 GAAGGCAGCATGGGGAAGCAAGG - Intergenic
1103256891 12:119549307-119549329 GGAGGTAACAAGTGGGAGAAGGG + Intergenic
1103989440 12:124788639-124788661 GGAGGCAGACAGTCCAAGTATGG - Intronic
1105089509 13:16262336-16262358 AGAGTCTGCAAGTGGACGTATGG + Intergenic
1105089743 13:16266610-16266632 AGAGTCTGCAAGTGGACGTATGG + Intergenic
1105089904 13:16269514-16269536 AGAGTCTGCAAGTGGACGTATGG + Intergenic
1105090220 13:16275329-16275351 AGAGTCTGCAAGTGGACGTATGG + Intergenic
1106111412 13:26780861-26780883 GGAGAGAGGAAGTGGAAGTGTGG + Intergenic
1106130400 13:26934702-26934724 AGAGGCAGCAAGAGGAAGGGAGG - Intergenic
1107034088 13:35882578-35882600 GGAGACAGAAAGCTGAAGTAGGG - Intronic
1107080175 13:36366446-36366468 GGAGGCAGGAAGTTGAAATAGGG - Intronic
1107257108 13:38441248-38441270 GAAGGGAGGGAGTGGAAGTAGGG + Intergenic
1108958159 13:56187371-56187393 GGAGGCACCAAGAGGGAGCAAGG - Intergenic
1109029475 13:57174706-57174728 GGATGCAACAAGTGTCAGTAAGG + Intergenic
1111886783 13:94031425-94031447 GGATGCAGCAAGTGGAATCTGGG - Intronic
1113391300 13:109899932-109899954 GGAGGAAGAAAGAGGAAGGAAGG - Intergenic
1113612661 13:111658425-111658447 GGAGGCAGGCAGGGGAAGTGTGG + Intronic
1114694411 14:24613004-24613026 GAAGGCAGCCAGTGGAATTGGGG - Intergenic
1115336632 14:32249015-32249037 GGAGGAAGCAGGAGGAAGCAAGG + Intergenic
1115949114 14:38699884-38699906 GGAGTCAGCAAAGGGAAATAGGG + Intergenic
1116244808 14:42395951-42395973 TGAGGCAGAAAATTGAAGTATGG + Intergenic
1116321333 14:43468118-43468140 GGGGGCATAAAGAGGAAGTATGG - Intergenic
1117193487 14:53316798-53316820 GAAGGCAGCCAGTGGAATTTGGG - Intergenic
1117240621 14:53829039-53829061 GAAGGCAGCAAGTGGAATTAGGG + Intergenic
1117642737 14:57817470-57817492 GGAGGCAATAAGGGGAAGCATGG - Intronic
1117719979 14:58619680-58619702 GGAGGCAGGAGGAAGAAGTATGG - Intergenic
1118163078 14:63310551-63310573 CTAGGCAGCAAGTTGAAGAAAGG - Intergenic
1121075623 14:91065897-91065919 GGATGCAGCAGCTGGAAGTGAGG + Intronic
1121725903 14:96149497-96149519 GAAGGCAGCCAGTGGAACTGGGG - Intergenic
1122738890 14:103859501-103859523 GGAGGGAGCGAGTGGAGGGAAGG + Intergenic
1123881583 15:24681115-24681137 GGAGTCAGCAAGTGGGAGGGAGG + Exonic
1123999594 15:25743918-25743940 GGAGGTTGTAAGTGGAATTAAGG - Intronic
1124153912 15:27208665-27208687 GGAGCCAGCAAGGGGGAGTCTGG + Intronic
1124497387 15:30194698-30194720 GGAGGCAGCAAGGCGAGGAAGGG + Intergenic
1124579066 15:30936349-30936371 GCAAGTAGCAAGTGGAAGTGAGG + Intronic
1124622071 15:31279448-31279470 GCAGGCAGCAAATGAAAGTGTGG - Intergenic
1124746186 15:32343949-32343971 GGAGGCAGCAAGGCGAGGAAGGG - Intergenic
1125987687 15:44071200-44071222 GAAGGCACCAAGTGGATGTGGGG - Intronic
1127089903 15:55456928-55456950 GAAGGCAGCCAGTGGAATTGGGG + Intronic
1127207831 15:56738851-56738873 GGTGGCAACAAGTTGAAGGAAGG + Intronic
1127284867 15:57523652-57523674 GGAGGAGGAAAGAGGAAGTAGGG + Intronic
1128549116 15:68586406-68586428 GGAGGTAGCAGGTGAAAGGAGGG + Intronic
1129113375 15:73351363-73351385 GTAGTCAGCAAGTGGATGCATGG - Intronic
1129227882 15:74180371-74180393 GCAGGCAGCACATGGAAGTGGGG + Intronic
1130821378 15:87499830-87499852 GCAGGCAGCCAGTGTAAGTTAGG + Intergenic
1131533273 15:93212824-93212846 AGTGACAGCAAGTGGAAGGAGGG + Intergenic
1133515981 16:6509500-6509522 GGAGACAGAAAGTAGAAGGATGG + Intronic
1136918697 16:34242739-34242761 AGAGTCTGCAAGTGGATGTATGG + Intergenic
1137378067 16:47971754-47971776 GGAGGGAGAGAGTGGAAGAAGGG - Intergenic
1137642223 16:50042404-50042426 TGAGGGAGCAAGTTGAAATAGGG - Intergenic
1137667080 16:50257265-50257287 AGAAGCAGCAAGTGGAAGGGTGG + Intronic
1138287392 16:55820793-55820815 GGAGGCAGGCAGAGGAAGGAGGG - Intronic
1138697102 16:58824767-58824789 GGAGGAAGGAAGTAGAAGTCAGG + Intergenic
1140766886 16:78168234-78168256 GAAGGCAGGAAGAGGAAGAATGG - Intronic
1141564328 16:84891294-84891316 GGAGGCTGGCAGTGGAAGCAGGG - Intronic
1144825186 17:18101786-18101808 TGAGGCAGCAAGGGGAGGAAGGG + Intronic
1145740574 17:27270735-27270757 GGTGGCAGCAAGAGAAAATAAGG - Intergenic
1146620557 17:34393878-34393900 GGTGGCAGAAAGTGGAAATAGGG + Intergenic
1146827292 17:36033743-36033765 GAAAGAAGCAGGTGGAAGTAGGG + Intergenic
1148046454 17:44747928-44747950 GCTGGCAGCAAGGGGAAGCAGGG - Intronic
1148115571 17:45172776-45172798 GGGGGCAGCTACCGGAAGTAGGG - Intergenic
1148686514 17:49503994-49504016 GGAGGGAGGAAGTGGAAGGGAGG - Intronic
1149207203 17:54262001-54262023 ACATGCAGGAAGTGGAAGTAGGG + Intergenic
1149700538 17:58651465-58651487 AAAGGCACCAAGTGGAAATAAGG + Intronic
1150223007 17:63507809-63507831 GGAGGCAGGGAGTGGAGGAAGGG + Intronic
1150623710 17:66827392-66827414 GGAGACAGCTATTGGAAGAAGGG - Intergenic
1150807435 17:68330283-68330305 GGAGACAGGAATTGGAAGTGGGG + Intronic
1151240268 17:72751968-72751990 AGAGGCAGGAAGTAGAAGGATGG - Intronic
1151499837 17:74481597-74481619 GGAGGCAGGAAGGGGAAGGTGGG + Intronic
1152243052 17:79170164-79170186 GGAGGAAGGAAGGGGAAGGAAGG + Intronic
1156888770 18:42165837-42165859 GGAGGCAGAACAGGGAAGTAGGG + Intergenic
1156969600 18:43139374-43139396 GGAGGCACCAAGAGCAAGTGAGG - Intergenic
1157204519 18:45687248-45687270 GGGGGCAGAAGGTGGAAGTTGGG + Intergenic
1157420744 18:47545814-47545836 GGAGGGAGCAAGGTGAAGTCGGG + Intergenic
1158038102 18:53059076-53059098 GGTGGCAGCAAGGAGAAGTGTGG + Intronic
1158670767 18:59471765-59471787 GGAGGCTGGAAGAGGAAGAAAGG + Intronic
1159410050 18:68061103-68061125 GGTGGCAGCAAGAGGAAATGAGG + Intergenic
1159970656 18:74648213-74648235 ATATGCAGCAAGTGGAAGTTAGG + Intronic
1161282052 19:3451257-3451279 AGAGGCAGGAAGGGGATGTATGG + Intronic
1162145082 19:8608596-8608618 GGAGGGAGCCAGTGGGAGAAAGG - Intronic
1162246336 19:9404948-9404970 GGTGGTAGCTAGTGGAAGTAAGG - Intergenic
1162931390 19:13959555-13959577 GGAGGCAGGAAGTGGGGGTGGGG - Intronic
1163114372 19:15180294-15180316 GGAGGCAGAAGGGGGATGTATGG - Intronic
1163242134 19:16070726-16070748 GGAGGCCCAAAGGGGAAGTAGGG - Intronic
1163949754 19:20572506-20572528 GGGGGCAGCACGCAGAAGTAGGG + Intronic
1165051785 19:33146487-33146509 GGAGGAAGGAAGGGGAAGGAAGG - Intronic
1165278952 19:34780594-34780616 GGAGGAAGGAAGGGGAAGCAAGG + Intergenic
1167202555 19:48076154-48076176 GGAGGCATGAAGTGGATGAAGGG + Intronic
1167353135 19:48988127-48988149 GGAGGCAGCGAGTGGGAGAAGGG - Intronic
1167533161 19:50031608-50031630 GGAGGCAGCAGGGGGTACTATGG - Intronic
925428930 2:3774437-3774459 GGAGGGAGGCAGTGGAAGAATGG - Intronic
925687888 2:6492092-6492114 GATGGCAGCCAGTGGAATTAAGG + Intergenic
925725954 2:6871235-6871257 CAAGGCAGCTAGTGGAAGAATGG - Intronic
925765686 2:7233140-7233162 GAAGGCAGCAAGGGGAAGAGTGG + Intergenic
926888317 2:17617715-17617737 GGAGGCAGCAAGTGGAAGTAAGG + Intronic
927370067 2:22344146-22344168 TGCTGCAGCAAGAGGAAGTAAGG + Intergenic
927372247 2:22369641-22369663 GGCGGCAGCAAGTGAATGAAAGG + Intergenic
927686392 2:25174353-25174375 GGAGGAAGGAAGTAGAAGGAGGG + Intergenic
928142402 2:28741237-28741259 GGAGGCAGAGAGTAGAATTATGG + Intergenic
928839502 2:35588050-35588072 GGAGGTAGCTAATGGAAGTGAGG - Intergenic
929810515 2:45185588-45185610 GTAGGGAGCAAGTGGAAAGAGGG - Intergenic
930358498 2:50348331-50348353 AGAGGCAGAAAGTGGAAGAATGG + Intronic
930424976 2:51201664-51201686 GGAGGGAAAAAGAGGAAGTAAGG - Intergenic
930644071 2:53885144-53885166 GGATGCAGCTAGTGGAACTAAGG - Intronic
931641361 2:64383407-64383429 GGAGAAAGCAAGAGGAAGCAGGG - Intergenic
932293981 2:70609185-70609207 CAAGGCAGGAAGTGGAAGGAAGG - Intronic
932389265 2:71370999-71371021 GGAGACAGAAAGTCGAAGGATGG - Intronic
932429847 2:71667694-71667716 GGAGGCAGCCAGAGGAAGCCAGG - Intronic
932497565 2:72153951-72153973 GGTGGGAGCAAGTGGCACTAAGG - Intergenic
932838107 2:75056325-75056347 AAAGCAAGCAAGTGGAAGTATGG - Intronic
933748151 2:85585454-85585476 GGAGGCAGGAAGAGGAAGTGGGG + Intronic
933896937 2:86819977-86819999 GGAGGAAGTAACTGCAAGTATGG + Intronic
934105964 2:88694674-88694696 GAAAGGAGCAAGTGGAAGGAGGG - Intronic
935171462 2:100613928-100613950 GGAGGGAGGAAGGGGAAGAAAGG - Intergenic
935324462 2:101923850-101923872 GGCTGGAGCAAGAGGAAGTAGGG - Intergenic
935562747 2:104575720-104575742 GGAGCCAGAAAGTGGAAGAATGG + Intergenic
935745878 2:106189906-106189928 GGAGTCAGGAAGAGGAAGTCAGG + Intronic
936526081 2:113242371-113242393 GGAGGCAGCAAGCCGAACCATGG + Intronic
936857640 2:116979730-116979752 GAAGGCAGTCAGTGGAAGTGGGG + Intergenic
937146049 2:119645708-119645730 GGAGGCAGCAATGGAAAGCAGGG - Intronic
937216655 2:120317448-120317470 GGAAGCAGCAGGTGGAGGTGGGG + Intergenic
938900084 2:135792301-135792323 GAAGGAAGCCAGTGGAATTAGGG + Intronic
940441187 2:153718638-153718660 GGAGGCAGCAGGTGTCAGGACGG + Intergenic
940486175 2:154297980-154298002 GGAGGTATCAAGTAGATGTATGG + Intronic
940920340 2:159298506-159298528 GGAGTCAGCAAAGGGAAATAGGG - Intergenic
941452159 2:165672631-165672653 GGAGTCAGCAAGAGTAAGTGAGG + Intronic
942834040 2:180271123-180271145 GGAGACAGAGAGTGGAAGGATGG - Intergenic
942980543 2:182075493-182075515 GGAAGTAGGAAGTAGAAGTAAGG + Intronic
943150516 2:184106873-184106895 GGAGGCAGACAGTGGAAATCTGG + Intergenic
944867159 2:203873820-203873842 GAAGGCAGCAGGTGGCAGAATGG + Exonic
945032745 2:205680879-205680901 GGAGGGAGGAAGAGGAAGGAGGG + Intergenic
945767444 2:213998416-213998438 GGAGGCAGCAAGAGAAAATGAGG - Intronic
945939618 2:215934978-215935000 GGAGGTAGAGAGTGGAAGAATGG - Intergenic
946650129 2:221884234-221884256 GGAGGTAGGAAGTGAAATTATGG - Intergenic
946734765 2:222743293-222743315 GGAGGGAGAAAGTGGAAGGGAGG - Intergenic
946798146 2:223378743-223378765 GGAGGAAGCATGTGGAAGGAGGG + Intergenic
946981866 2:225226866-225226888 GGAGGCAGATAGTGGAGGTTAGG + Intergenic
947206122 2:227662749-227662771 GGAGGCAGCAATGAGAAGCAAGG - Intergenic
947422294 2:229951787-229951809 GAAGTCAGCAAGTGGAAACAAGG + Intronic
948010259 2:234646291-234646313 GTAGGGAGGCAGTGGAAGTAGGG - Intergenic
948010491 2:234647195-234647217 GTAGGGAGGCAGTGGAAGTAGGG - Intergenic
948010581 2:234647561-234647583 GTAGGGAGGCAGTGGAAGTAGGG - Intergenic
948010787 2:234648392-234648414 GTAGGGAGGCAGTGGAAGTAGGG - Intergenic
949049261 2:241888473-241888495 GGGGGCAGCAAGAGGGAGAATGG - Intergenic
949049286 2:241888549-241888571 GGGGGCAGCAAGAGGGAGAATGG - Intergenic
949049310 2:241888624-241888646 GGGGGCAGCAAGAGGGAGAATGG - Intergenic
949049335 2:241888700-241888722 GGGGGCAGCAAGAGGGAGAATGG - Intergenic
1169000334 20:2163632-2163654 AGAGGAAGCAAGGGGAAGAAGGG + Intronic
1169408831 20:5349570-5349592 GGAGTCAGGAAGTGGAAGGCGGG - Intergenic
1169760049 20:9081480-9081502 GGAGTCAGCCAGTTGAAGAAGGG - Intronic
1169851230 20:10053715-10053737 GGAGGCGGCAGGTGGGAGGAAGG - Intronic
1170422542 20:16207168-16207190 GGAGATGGCAAGTGGTAGTAGGG - Intergenic
1170601245 20:17843226-17843248 GGAGGCAGCACAGGGAAGAAAGG - Intergenic
1170801951 20:19597753-19597775 GGAGGCAGAAAGTAGAATGATGG - Intronic
1171061398 20:21966055-21966077 GAAGGCACCATGTGGCAGTAAGG + Intergenic
1172094829 20:32455554-32455576 GGAGGCAGCTTGTGGAAGTGTGG + Intronic
1172509870 20:35493162-35493184 CGTGGCATCAAGTGGAAGTAGGG + Intronic
1173290793 20:41713238-41713260 GCAGACAGCAAGAGGAAGAATGG - Intergenic
1173294285 20:41742212-41742234 GAAGGCAGGAAGGGGAAGGAAGG - Intergenic
1173393596 20:42657131-42657153 GGTGGCAGGAAGTAGAAGTGTGG - Intronic
1173428820 20:42967712-42967734 GGAGGCAGCATGTGGGGGTGGGG - Intronic
1173443448 20:43097160-43097182 GGAGCCAGGAAGTGGAAGTATGG + Intronic
1174025495 20:47570547-47570569 GGAGGAAGTAACTGGAAGTGTGG - Intronic
1174137558 20:48391049-48391071 GAAGGAAGGAAGTGGAAGGAGGG + Intergenic
1174502560 20:50996456-50996478 GGAGACAGCCAGTGGGAGGAAGG - Intergenic
1174746243 20:53066285-53066307 GCAAGTAGCAAGTGGAAGTCAGG + Intronic
1174754230 20:53141959-53141981 GCAGGAAGCAAGTGGATGTCAGG + Intronic
1175023683 20:55878592-55878614 AGAGGCAGAAAGTGGAATTTTGG + Intergenic
1175858202 20:62133968-62133990 GGACGCAGCTAGTGGCAGGAGGG - Intronic
1176875552 21:14123476-14123498 GGTGGGAGCAAGAGGAAGGATGG - Intronic
1177070523 21:16500373-16500395 AGAGGCAGTAAGTGGAAAGACGG - Intergenic
1177714208 21:24817957-24817979 GGAGGCAGGAAGTCCAAGTTTGG - Intergenic
1179409577 21:41152332-41152354 GGCGGCAGCAAGGAGAAGAATGG + Intergenic
1179443250 21:41410884-41410906 GAGGGCAGCCAGTGGAAGTGGGG + Intergenic
1180926745 22:19560229-19560251 GGGGGCAGCAACTGGAGGCAGGG + Intergenic
1182827616 22:33279327-33279349 GGAGAGAGGAAGTGGAAGTCTGG + Intronic
1183007646 22:34916634-34916656 GGAGGCAGAGAGGGGAAGGAAGG + Intergenic
1183539657 22:38422801-38422823 GGAGGGAGGAAGAGGAAGAAAGG - Intergenic
1183670520 22:39269914-39269936 GGCGGCAGCAACTGGAGTTAGGG - Intergenic
1183730425 22:39615403-39615425 GGAGGAAGCAAGGGGCAGGAGGG + Intronic
1184843058 22:47063767-47063789 GGAGGCGGGAAGGGGAAGCATGG - Intronic
949215317 3:1560397-1560419 GGCGGCAGCAAGGAGAAGTGTGG - Intergenic
949357410 3:3196605-3196627 GGAGGCAGCGGGTGGAAGAGGGG - Intergenic
949606477 3:5659502-5659524 GAAGGCAGGAAGGGGAAGCATGG - Intergenic
950482351 3:13252226-13252248 AGAGACAGAAAGTGGAAGGATGG - Intergenic
950983354 3:17332648-17332670 AGAAACAGCCAGTGGAAGTAGGG + Intronic
951057682 3:18166594-18166616 GGAGGAAGGAAGTGAGAGTAAGG + Intronic
951683727 3:25321910-25321932 GGAGGCAGGCAGTAGAAGGATGG + Intronic
952183306 3:30942046-30942068 GAAGGCAGCCAGTGGAACTGGGG - Intergenic
952217915 3:31295972-31295994 AGAGGCAGCAAGTAGAAGAATGG + Intergenic
952984945 3:38770787-38770809 GAAGGCAGCCAGTGGAATCAGGG - Intronic
953086083 3:39668944-39668966 GGAAGCAGCAAGTGATAGTGTGG + Intergenic
953361770 3:42303399-42303421 GGTGGCAGGAAGTGGAAGAGGGG + Intergenic
954372440 3:50175947-50175969 GGTGGCAGCAGGTGGCAGGATGG - Intronic
954757241 3:52847746-52847768 TGAGGCTGCAAATGGAATTAAGG + Intronic
954852696 3:53617011-53617033 GGAGGCAGCATCTGGAAGCAAGG - Intronic
955627244 3:60931496-60931518 GGCGGCAGCATTTGGAATTAGGG - Intronic
957627458 3:82672049-82672071 GGAGGGAGTCAGTGGGAGTAGGG - Intergenic
957669265 3:83280184-83280206 GGAGGCAGCAAGAGAAAATGGGG + Intergenic
959171899 3:102854231-102854253 GGTGGCAGCAAGAGAAAATAAGG + Intergenic
959275550 3:104272965-104272987 GGAGACAGAAGGTGAAAGTAGGG + Intergenic
960712549 3:120545459-120545481 GAAGGCAGCCAGTGGGATTAGGG - Intergenic
960959629 3:123061136-123061158 GGAGGCAGAAAGTAGAAACATGG - Intergenic
961080731 3:124025006-124025028 GGATGCAGGAAGTGGAGGAAGGG + Intergenic
961210544 3:125121818-125121840 GGAACCAGAAAGTGAAAGTAGGG + Intronic
961333095 3:126154419-126154441 GGGGGCACCCAGTGGGAGTAGGG + Intronic
961562305 3:127739017-127739039 GGAGGCACCAGGTGGAATGAAGG + Intronic
962320689 3:134388094-134388116 GGAGGGAGAAAGTGGCAGTTTGG - Intergenic
964212816 3:154246822-154246844 GGTGGCAGTAAGTGGAAGAGAGG + Intronic
964394687 3:156233301-156233323 GGGGGCTGCAAGTGTAAATAGGG + Intronic
964949008 3:162263834-162263856 GGAGGCAGCCAGCTGAAGTTAGG + Intergenic
966652829 3:182320577-182320599 AGAGGCACAAAGAGGAAGTAGGG + Intergenic
967065918 3:185915196-185915218 GGTCCCAGCAAGTGGAAATAAGG - Intergenic
967382807 3:188879263-188879285 GGAGGAAGGAAGAGGAAGAAAGG - Exonic
968547351 4:1205944-1205966 GGAGGCAGCCAGGGGAGCTAGGG - Intronic
969581609 4:8068673-8068695 GGAAGAAGCAAGGGGAAGTGTGG - Intronic
969586462 4:8097006-8097028 GGAGGGAGCAGGAGGAAGAAGGG + Intronic
970172189 4:13301221-13301243 GGAGGCAGGAAGGAGAAGTGTGG + Intergenic
970563631 4:17309060-17309082 GGAGGCAGTAAGTGGTAGTGGGG - Intergenic
971709689 4:30094407-30094429 GAAGGCAGAAAGTGGAGGGAGGG + Intergenic
974125547 4:57691950-57691972 GGAGGCAGGAAGGAGAAGTGTGG - Intergenic
974472079 4:62331494-62331516 GAGGGCAGCCAGTGGAATTAGGG + Intergenic
975280096 4:72552002-72552024 GGAGGAAGAAACTGGAAGGAGGG + Intronic
975497578 4:75051771-75051793 GGAGGCTGCAAGTTGAAATTAGG - Intergenic
976332165 4:83845033-83845055 GGAGACAGCAAGTGAAGGCAAGG + Intergenic
977246641 4:94639284-94639306 GTATGCAGCACGTGGAAGCAGGG + Intronic
977356266 4:95951620-95951642 GGAGGCAGCAAGGAGAAGGGGGG + Intergenic
977463793 4:97358032-97358054 GGTGGCAGCAAGAGAAAATAAGG + Intronic
977513789 4:97995108-97995130 GCAGGCAGCATGGGGGAGTAGGG - Intronic
977749871 4:100596447-100596469 GGTGGCAGCAAGTGGAAATCTGG - Intronic
980082105 4:128355075-128355097 AGAGGCAGCAAGAGGAAGGAGGG - Intergenic
980227189 4:130001743-130001765 GGAGGCAGAAAGTGGAAAGATGG + Intergenic
980369010 4:131842947-131842969 GGAGGAAGCATTTGGAAATAGGG - Intergenic
980865848 4:138553021-138553043 GGAGGCACCAAGAGCAAGTGAGG - Intergenic
981054395 4:140345251-140345273 GGAGGCGGCAATTGGGAGCAAGG - Intronic
981064122 4:140463247-140463269 GAAGGCAGCCAGTGGAACTGGGG + Intronic
981143245 4:141295452-141295474 GGATGGGGCAATTGGAAGTATGG + Intergenic
982607993 4:157538326-157538348 GGTGGCAGCAAGAGAAAATAAGG + Intergenic
982912014 4:161154485-161154507 GGTAACAGCAATTGGAAGTAAGG + Intergenic
983067984 4:163234819-163234841 GGAGGCAGCAAGAGAAAATGAGG + Intergenic
984404312 4:179307493-179307515 GGAGACAGACAGTGGAGGTAGGG + Intergenic
984900489 4:184581822-184581844 GGTGGCAGCAAGAGAAAGTGAGG + Intergenic
985567252 5:625473-625495 GGAGGCAGCCATTGGCAGCACGG + Intronic
985679899 5:1250409-1250431 GGAGGCTGCAGGTGGAATCACGG - Intergenic
986392824 5:7301406-7301428 GGAGGCAGCAGGAGGAGCTACGG - Intergenic
986685330 5:10271190-10271212 GTGGGCAGCACGTGGAAATACGG - Intergenic
986827462 5:11537041-11537063 GGAGGCAGCAGGTGGGGGGAAGG + Intronic
987617133 5:20290793-20290815 GGAGGCAGAAGGTGGAAGTGTGG + Intronic
988862686 5:35300960-35300982 GGAGGAAGGAAGAGGAAATAGGG - Intergenic
989445531 5:41524324-41524346 GAAGGCAGGAAGTGGAAGGAGGG - Intergenic
990390401 5:55313787-55313809 GGAGGGAGGAAATGGAAGAAGGG - Intronic
991394471 5:66189918-66189940 GGAGACAGAAAGTAGAAGGATGG - Intergenic
992305099 5:75429100-75429122 GTAGGCTGGAGGTGGAAGTAGGG - Intronic
992638878 5:78751601-78751623 GGAGGGTGCAAGTGGCAGCAAGG - Intronic
993068866 5:83133802-83133824 GGAGGCACCAAGAGCAAGCAAGG - Intronic
993366116 5:87035797-87035819 GAAGGCAGCCAGTGGAATTGGGG - Intergenic
993836012 5:92821365-92821387 GGAAGCAGCAATAGGAAGGAAGG + Intergenic
994046523 5:95316642-95316664 GGCAGCAGCAAGGAGAAGTACGG + Intergenic
994271840 5:97786773-97786795 GGAGGAAGCAAGGGGGTGTAAGG + Intergenic
994319894 5:98382012-98382034 AGAGGCAGGAAATGGAAGTGGGG - Intergenic
997376868 5:133403659-133403681 GCAGGAAGGAAGTGGAAGGATGG + Intronic
997388819 5:133496904-133496926 GGAGGCAGTAAGGGGGAGTCAGG - Intronic
999108554 5:149094985-149095007 GAAGGCAGACAGTGGAATTAGGG + Intergenic
999505282 5:152188234-152188256 GGAGGCAGGAAAGGGATGTAGGG + Intergenic
999534598 5:152503228-152503250 TGAAGCACCAAGGGGAAGTAGGG + Intergenic
1000264413 5:159621066-159621088 GAAGGCAGCCAGTGGAATTGAGG + Intergenic
1000967084 5:167670673-167670695 AGAGACAGGAAGTGGAAGTCAGG - Intronic
1001081829 5:168672906-168672928 GGAGGCAGGAGATGGAAGCAGGG - Intronic
1001120068 5:168972703-168972725 GAAGACAGCAAGAGGAAGGAAGG - Intronic
1002437221 5:179238940-179238962 AGAGGCAGGAAGTGGATGAATGG + Intronic
1002446690 5:179294539-179294561 GGAGGCAGCTTGTGGAGGTCCGG + Intronic
1002618140 5:180468087-180468109 TGTGGCAGTAAGTGGAAGGACGG - Intergenic
1003018877 6:2492695-2492717 GGAGACAGCAAAGGGAAGGAAGG + Intergenic
1003409340 6:5849542-5849564 GCAGGCAGGAGGTGGAAGGAAGG + Intergenic
1004139290 6:13000648-13000670 GGAGGGAGGAAGGGGAAGGAAGG + Intronic
1004565234 6:16789702-16789724 GGAAGCAGAAAGTGAAAGTTTGG - Intergenic
1005211278 6:23467004-23467026 TGAGGCAGCAACTGGGAGTGGGG + Intergenic
1005555485 6:26977135-26977157 GGATGCGGGAAGTGGAAGCAGGG - Intergenic
1005692925 6:28324302-28324324 AGAGGTTGCAAGTGGAAGGATGG + Intergenic
1005991084 6:30902588-30902610 GGAGGCAGCATGTGCCAGGAGGG - Intergenic
1007539787 6:42630638-42630660 GCAGGCAGTAAGAGGAAGTTTGG - Intronic
1009402937 6:63277735-63277757 GAAGGCAGCAAGAGAAAGAAAGG + Intronic
1009418897 6:63443447-63443469 GGAGGCACCAAGAGCAAGTGAGG + Intergenic
1009437890 6:63638257-63638279 GGAGGCAGCAAGTGGCAATTTGG + Intronic
1009779891 6:68256236-68256258 GAAGGCAACAAGTGGAATTGGGG - Intergenic
1009930663 6:70173778-70173800 AGAGGCTGCTAGAGGAAGTAGGG + Intronic
1010468306 6:76194772-76194794 GGAGACAACAAGTGAAAGGATGG - Intergenic
1010801947 6:80186689-80186711 GAAGGCAGCCAGTGGAATTAGGG - Intronic
1010975849 6:82312893-82312915 GAAGGCAGCCAGTGGAACTAGGG + Intergenic
1012239362 6:96854549-96854571 GATGGCAGCAAGTGGAAATTTGG + Intergenic
1013091257 6:106902658-106902680 GGAGCAAGCAAGTGAAAGTGAGG - Intergenic
1013318836 6:108967162-108967184 GAGGGCAGCAAGTGGAAGCCTGG - Intronic
1014278656 6:119416900-119416922 GAAGGCAGCCAGTGGAACTGGGG - Intergenic
1014459061 6:121673568-121673590 GAAGGGAGCAAGGGGAAGGAAGG - Intergenic
1014750152 6:125246025-125246047 GAAGGCAGCCAGTGGAATTAGGG - Intronic
1014820075 6:125979223-125979245 GGAGAAAGGATGTGGAAGTAGGG + Exonic
1014930705 6:127332580-127332602 GGAGGCAGGAGGTGGATGTAGGG + Intronic
1015523049 6:134150658-134150680 GGTGGCAGCAAGAGAAAGTGAGG - Intergenic
1015595030 6:134858606-134858628 GGTGGCAGCAAGGAGAAGTGCGG + Intergenic
1016724551 6:147347009-147347031 GGAGGCAGAGAGTGGAATTCTGG + Intronic
1016924700 6:149332076-149332098 GGCGCAAGCAATTGGAAGTATGG + Intronic
1017711577 6:157173686-157173708 GTAGGCAACAAGTGGAAATAAGG - Intronic
1018725263 6:166607581-166607603 GGAGACAGAAAGTGGATGTAGGG + Intronic
1022628450 7:32062225-32062247 TGAGGAAGAAAGTGGAATTAAGG - Intronic
1022976483 7:35561976-35561998 AGAGGCAGCAAATAGAAGAATGG + Intergenic
1024639754 7:51318985-51319007 AGAGGCAGCAAGAGGAAGTATGG + Intergenic
1025149484 7:56537686-56537708 AGAGGCAGGAAGGGAAAGTAGGG + Intergenic
1025308201 7:57887566-57887588 GGAGTCTGCAAGTGGACGTTTGG - Intergenic
1025308474 7:57892666-57892688 GGAGTCTGCAAGTGGACGTTTGG - Intergenic
1026260278 7:68748866-68748888 GGAAGAAGCAAATGGAATTAAGG + Intergenic
1028273695 7:88824362-88824384 GGAGGCAGCAAGGAGAAATGTGG - Intronic
1028772426 7:94641546-94641568 GGACCAAGCATGTGGAAGTAAGG + Intronic
1029317757 7:99729815-99729837 GGAGTCAGCAAGGGGAGATAGGG - Intronic
1030194389 7:106838401-106838423 GGAGTCAGCAAAGGGAAATAGGG - Intergenic
1032661129 7:133984919-133984941 GGAAGCAGCAGGAGAAAGTATGG + Intronic
1033063021 7:138126038-138126060 GGAGTCAGCATTTTGAAGTAGGG - Intergenic
1033157473 7:138969313-138969335 GGAGACAGGAAGTAGAAGGATGG - Intronic
1034069183 7:148166076-148166098 GGAGGCTGCAATTTCAAGTAGGG - Intronic
1035136463 7:156708550-156708572 GAAGGCAGCCAGTGGAATTAGGG + Intronic
1035454889 7:159001718-159001740 GGAGGCATCGAGTGGAAGTGAGG - Intergenic
1035546503 8:485707-485729 CGAGGCAGCAACTGGAAGCCTGG - Intergenic
1037779543 8:21858324-21858346 GGAGGCAGGAAGTGGGAGGAGGG + Intergenic
1038927249 8:32154354-32154376 GAAGGCAGGAAGTGGAAGGGAGG - Intronic
1038927255 8:32154376-32154398 GAAGGCAGGAAGTGGGAGAAAGG - Intronic
1038927260 8:32154398-32154420 GAAGGCAGGAAGTGGAAGGGAGG - Intronic
1039068659 8:33631531-33631553 GGAGGCACCAAGAGGGAGCAAGG - Intergenic
1040868086 8:52070779-52070801 GAAGGCAGCCAGTGGAATTAGGG - Intergenic
1041788637 8:61664813-61664835 GGAAGCAGGAAGGGGAAGGAGGG + Intronic
1042896864 8:73680031-73680053 GAAGGCAGTCAGTGGAACTAGGG + Intronic
1043607357 8:82018567-82018589 GGAGGCAGTATATGGAAGTGTGG - Intergenic
1044430943 8:92105501-92105523 GGAGGTAGCAAGTGGGATTAAGG - Intergenic
1044442217 8:92236330-92236352 GGCGGCAGCAAGAGAAAATAAGG + Intergenic
1045358053 8:101406650-101406672 GGAGGCAGCAGCAGGAAGTAAGG - Intergenic
1045616482 8:103919346-103919368 GGAGTGAGCAAGAGGAAGAATGG + Intronic
1045777713 8:105825258-105825280 GGAGGCAGCAGGTGGAAATGTGG + Intergenic
1048213257 8:132474842-132474864 GGAGTCACCAAGTGAAAGCAGGG + Intronic
1048916112 8:139184630-139184652 GAAGACAGCAAGAGGAAGAAAGG + Intergenic
1049018409 8:139937626-139937648 GGAGGCAGCAAGGAGAGGAAGGG + Intronic
1049373495 8:142278587-142278609 GGAGGCGGCAGGAGGAAGCACGG + Intronic
1050133979 9:2442142-2442164 GAAGGCAGCCAGTGGAATTAGGG - Intergenic
1050647977 9:7742588-7742610 GGAGGCAGGAAGTGCAAGGTGGG + Intergenic
1051592750 9:18793224-18793246 AAAGGCAGGAAGTAGAAGTAAGG - Intronic
1052757885 9:32559369-32559391 GGAGGGCACAAGTGGAAGCAGGG - Intronic
1053171506 9:35889348-35889370 AGATACAGCAAGAGGAAGTAAGG - Intergenic
1053430488 9:38038845-38038867 GGAGGTATCAAGGAGAAGTAGGG + Intronic
1053633373 9:39968622-39968644 GGAGGAAGCATTTGGAAATAGGG - Intergenic
1053772374 9:41494858-41494880 GGAGGAAGCATTTGGAAATAGGG + Intergenic
1054210514 9:62282075-62282097 GGAGGAAGCATTTGGAAATAGGG + Intergenic
1054314472 9:63566847-63566869 GGAGGAAGCATTTGGAAATAGGG - Intergenic
1055179288 9:73363477-73363499 GGAGTCAGAAAGTGGAAACATGG + Intergenic
1056846702 9:90044459-90044481 GGAGACAGAAAGTGGAATGACGG + Intergenic
1058342823 9:103919816-103919838 GAAGGCAGCCAGCGGAATTAGGG + Intergenic
1059394838 9:114027860-114027882 CTAGGCAGCAAGAGGAAGCAGGG - Intronic
1059589883 9:115647362-115647384 GGAGGCAGGAAATGGAAGGGAGG - Intergenic
1061049579 9:128186470-128186492 GGAGGCAGGGAGTGGGAGTGGGG - Intronic
1061498257 9:130987935-130987957 GGAGGCAGGAAGCGGAGGGACGG + Intergenic
1061663589 9:132147329-132147351 GGAAGTAGGGAGTGGAAGTAGGG - Intergenic
1061734075 9:132640399-132640421 GTAGGGAGCAAGGGGGAGTAGGG + Intronic
1061928760 9:133821355-133821377 GGAGGCAGCGAGGGAAACTAGGG + Intronic
1062144035 9:134979015-134979037 GGAGGCAGGGAGGGGAAGGAAGG + Intergenic
1185472820 X:394884-394906 GGAGGCAGAAAGTGGATGGGTGG - Intergenic
1186991868 X:15078469-15078491 GGCGGCAGCAAGAGGAAATGAGG - Intergenic
1187555334 X:20345567-20345589 GGTGGCAGCAAGAGAAAATAAGG - Intergenic
1187719662 X:22137807-22137829 GGAGGCTGCAGTTGGAAGTCAGG - Intronic
1189789073 X:44586177-44586199 GGAGGCCACAAGTGGAAGTGAGG + Intergenic
1190375447 X:49784477-49784499 GGAGACATCATGTGTAAGTATGG + Intergenic
1190439906 X:50467151-50467173 GGTGGCAGCAAGTGTAAGTAAGG - Intronic
1190781463 X:53600277-53600299 GGATGGAGCAGCTGGAAGTATGG - Exonic
1191031055 X:55972350-55972372 GGAGATAGAGAGTGGAAGTATGG + Intergenic
1191116288 X:56856876-56856898 GGAGGCAGCAAGAGGAAATGAGG + Intergenic
1192477904 X:71459436-71459458 TGAGGCAGCAAGTGGAGGGATGG + Intronic
1193216456 X:78870055-78870077 GGAGGCAGAAAGTGAGAGAAGGG + Intergenic
1193422233 X:81295415-81295437 GGAGGCAGCAAGAGAAAATGAGG - Intronic
1193924019 X:87463915-87463937 GAAGGCAGCCATTGGAATTAGGG + Intergenic
1193987796 X:88267747-88267769 GGAGTAAGCAGATGGAAGTAGGG - Intergenic
1195129438 X:101839204-101839226 GGAGGCAGGAAGCGGAAGGCAGG + Intronic
1195176800 X:102320625-102320647 GGAGGCAGGAAGCGGAAGGCAGG - Intronic
1195182064 X:102366468-102366490 GGAGGCAGGAAGCGGAAGGCAGG + Intronic
1195202662 X:102565314-102565336 GGAGGCAGGAAGGGGAAGGCAGG - Intergenic
1195227893 X:102817341-102817363 GGTGGCAGCAAGAGAAAATAAGG + Intergenic
1196797088 X:119511070-119511092 GGAAGCAGCAAGGGGAAGGAGGG - Intergenic
1198191021 X:134306099-134306121 GGAGACAGAAAGTAGAAGGAGGG + Intergenic
1199191555 X:144977598-144977620 GGAGGCGGCAAGAGAAAATAGGG - Intergenic
1199330727 X:146555008-146555030 GGAGGCAGCAAGAGTAAATGAGG - Intergenic
1199675865 X:150188911-150188933 CCAGGCAGCAAGTGGTAGTGAGG + Intergenic
1199782508 X:151075521-151075543 GAAGGGCACAAGTGGAAGTAGGG - Intergenic
1201146473 Y:11067691-11067713 GGAGGGAGCAAGAGGAAGGGAGG + Intergenic
1201229742 Y:11852645-11852667 GGAGGGAGCATGTGGAGGAAGGG + Intergenic
1202068250 Y:20962680-20962702 GGAGACTGCAAGTGAAAGTCTGG - Intergenic