ID: 926888321

View in Genome Browser
Species Human (GRCh38)
Location 2:17617760-17617782
Sequence CCTGACAAGCTGAGGATGAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 203}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926888321_926888328 2 Left 926888321 2:17617760-17617782 CCGTTCATCCTCAGCTTGTCAGG 0: 1
1: 0
2: 3
3: 13
4: 203
Right 926888328 2:17617785-17617807 GGGCATGCTGGAATTGAACAGGG 0: 1
1: 0
2: 1
3: 10
4: 158
926888321_926888329 27 Left 926888321 2:17617760-17617782 CCGTTCATCCTCAGCTTGTCAGG 0: 1
1: 0
2: 3
3: 13
4: 203
Right 926888329 2:17617810-17617832 GAATTGTTGCCCCCATCATGTGG 0: 1
1: 0
2: 0
3: 1
4: 69
926888321_926888327 1 Left 926888321 2:17617760-17617782 CCGTTCATCCTCAGCTTGTCAGG 0: 1
1: 0
2: 3
3: 13
4: 203
Right 926888327 2:17617784-17617806 TGGGCATGCTGGAATTGAACAGG 0: 1
1: 0
2: 1
3: 19
4: 224
926888321_926888326 -10 Left 926888321 2:17617760-17617782 CCGTTCATCCTCAGCTTGTCAGG 0: 1
1: 0
2: 3
3: 13
4: 203
Right 926888326 2:17617773-17617795 GCTTGTCAGGCTGGGCATGCTGG 0: 1
1: 0
2: 5
3: 87
4: 875

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926888321 Original CRISPR CCTGACAAGCTGAGGATGAA CGG (reversed) Intronic
900954622 1:5878866-5878888 TGGGACCAGCTGAGGATGAAGGG + Intronic
901190204 1:7405444-7405466 CCTGAGAAGTTAAGGCTGAAGGG - Intronic
903304644 1:22404217-22404239 GCTGGAAAGCTGAGGGTGAAGGG + Intergenic
904685776 1:32259266-32259288 CCTGAGAAGCTGTGAATGAGAGG - Intronic
907272874 1:53300977-53300999 CCTCACAAGGTGAGAGTGAAAGG + Intronic
907423004 1:54359840-54359862 CCTGACAGGCTGAGGATAAATGG + Intronic
911541584 1:99163969-99163991 CCTCACCAGCTGTGGCTGAAAGG + Intergenic
915868162 1:159528183-159528205 CCTGACAAGCTAAGGTGGCATGG + Intergenic
919274433 1:195394369-195394391 CCTGGGAAGCTGAGGAGGCAGGG + Intergenic
919589317 1:199480631-199480653 CCTGACTAGCTGAGGGCAAAGGG - Intergenic
922533002 1:226358623-226358645 CCTTCCATGCTGAGGCTGAATGG + Intergenic
923036467 1:230288159-230288181 CCTGAGAAGCTGAGGCTGATGGG + Intergenic
923627368 1:235625029-235625051 GCTGCCAAGCTGATGAGGAAGGG + Intronic
1063228345 10:4038245-4038267 CCTCCCAAGGTGAGGATGATTGG + Intergenic
1064008898 10:11719622-11719644 CCTGGCCACCTGAGGCTGAAGGG - Intergenic
1065827884 10:29588449-29588471 CCAGAGAAGCAGAGAATGAATGG - Intronic
1065949979 10:30642853-30642875 CCAGAGAAGCGGAGAATGAATGG + Intergenic
1067142405 10:43668368-43668390 CCTGAAAGGCTGAGGAGGGAGGG - Intergenic
1067769229 10:49111441-49111463 TCTGACAAGCTGGGCATGCATGG - Intronic
1075538695 10:123294351-123294373 CCTGAGATGCTGAGGAAGATGGG - Intergenic
1076003388 10:126929688-126929710 CCTGAGAACCTCAGGATGGAGGG + Intronic
1077138131 11:1011718-1011740 CCTGACATGCTGTGGAGGCAGGG + Exonic
1079953273 11:26830889-26830911 CCTGTCAAGCTGTGCATAAAAGG + Intergenic
1080666581 11:34341692-34341714 CCTGACAAGCTGTGAGTGAGAGG - Intronic
1081614012 11:44579757-44579779 CCTGCCAAGCTGGGAATAAAGGG - Intronic
1082270523 11:50164871-50164893 CCAGACCAGATGAGGAAGAATGG - Intergenic
1082926353 11:58551407-58551429 CCTGAGGAGTTTAGGATGAAAGG - Intronic
1083161487 11:60857081-60857103 GCTGAGATGCTGAGGTTGAAGGG - Intergenic
1084287855 11:68143257-68143279 GCTGCCAAGGTGAGGAAGAAAGG - Intergenic
1084936921 11:72591805-72591827 CCTGCCATGGTGAGGATGGACGG + Intronic
1087011742 11:93520834-93520856 CGTGACATGCTGAAGGTGAAAGG - Intronic
1087078183 11:94144745-94144767 TATGACACCCTGAGGATGAATGG - Intronic
1089201165 11:116725589-116725611 CCTGACAGGCTGAGGAACAAGGG + Intergenic
1090310992 11:125739340-125739362 GCTGGCATGCTGAGGAGGAAAGG + Intergenic
1090623005 11:128578186-128578208 CCTGGCAAGCTTTGGGTGAAAGG - Intronic
1094222936 12:28013744-28013766 GCTCACAAGGTGGGGATGAAAGG - Intergenic
1094294968 12:28895375-28895397 CGTGGCAAGCTGAAGGTGAAAGG + Intergenic
1096516007 12:52155585-52155607 TCTGACAGGCTGGGGAGGAAGGG + Intergenic
1098708980 12:73730137-73730159 GCTGACACACTAAGGATGAACGG - Intergenic
1100201562 12:92304332-92304354 CCTAACAAGCTGAGAATGGGTGG + Intergenic
1101220283 12:102631922-102631944 CCTGACAACTTGGGAATGAATGG + Intergenic
1102232562 12:111273684-111273706 CCTGGCAAGTGGAGGAAGAAAGG + Intronic
1105401786 13:20102643-20102665 CTTCACACGCTGAGGATTAAAGG - Intergenic
1105994680 13:25658915-25658937 CCTGGTGAGCTGTGGATGAAGGG + Intronic
1108583480 13:51847401-51847423 CCTGATGATCTGAGGTTGAACGG + Intergenic
1109736872 13:66497551-66497573 CCTGACAAGCTGAGAAAGAAAGG - Intronic
1109800845 13:67376508-67376530 CCTGACAATCAGAATATGAAAGG + Intergenic
1110677125 13:78262260-78262282 CCTGACAAGAACAGTATGAAGGG + Intergenic
1111026910 13:82539142-82539164 CCTGGCAGGCTGAGGTTGCAAGG - Intergenic
1111947580 13:94681851-94681873 CCTCACAAGGTGAGTGTGAATGG - Intergenic
1112123111 13:96434683-96434705 CCAGAAAAGCTCAGGAAGAAGGG - Intronic
1112872178 13:103986551-103986573 ACAAACAAGCTGAGAATGAATGG - Intergenic
1114423008 14:22600311-22600333 CTTGAAAAGCTGAGGCTGGAAGG + Intronic
1114530224 14:23390755-23390777 CCTGAGAACCTGTGGTTGAAGGG + Intronic
1114634023 14:24177493-24177515 CCTGAGGAGCTGAGGCTGACAGG + Exonic
1116509025 14:45720351-45720373 ACTGAGAAGCTGAGGATCTAAGG - Intergenic
1118575432 14:67237705-67237727 GATGACAAGATGAGGAAGAAGGG + Intergenic
1118784469 14:69034573-69034595 CCTGGCAGGCTGGGGGTGAAGGG + Intergenic
1119765178 14:77183300-77183322 GCTGAGAAGCTGAGGCTGCAAGG + Intronic
1120718409 14:87865054-87865076 CCTGACAATGTGTGCATGAATGG - Intronic
1122559663 14:102603398-102603420 CCTGAGAGGCTGAGGATGCAGGG - Intronic
1123805597 15:23869189-23869211 CCTGAAAAGCTGAATCTGAAAGG - Intergenic
1123807912 15:23894427-23894449 CATGACAAGCCCAGGATGAAGGG - Intergenic
1125530955 15:40413021-40413043 CTGGACAAGCTGGGGATGAGGGG + Exonic
1126222151 15:46226341-46226363 CCTAACAAGCAGTGGATTAAGGG - Intergenic
1126299406 15:47179020-47179042 ACTTACAAGATGAAGATGAAAGG + Intergenic
1129322703 15:74783535-74783557 CCTGTATAGCTGGGGATGAAAGG - Intronic
1130535465 15:84782336-84782358 CCTGAGAAGCTGAGGGAGTATGG + Intronic
1130616512 15:85414042-85414064 CCTGAAAAGCAGAGGAAAAAAGG + Intronic
1130644339 15:85710509-85710531 CCTGAGAAGCCGAGTAGGAAGGG - Intronic
1130845286 15:87738389-87738411 CCTGCCAATGTCAGGATGAATGG + Intergenic
1130974468 15:88762673-88762695 CCTGAGGAGCTCAGGAAGAAGGG - Intergenic
1131467458 15:92667297-92667319 CCAGAAAAGCTGAGGGTGAGAGG + Intronic
1131817623 15:96237765-96237787 CCTGAAAAGCACAGGATGATAGG - Intergenic
1132478273 16:153333-153355 TCTGACAAGCAGAGGGTGAAAGG + Intronic
1132480358 16:163923-163945 TCTGACAAGCAGAGGGTGAAAGG + Intronic
1133584289 16:7177320-7177342 CCTCAAGAGCTGAGGATGCAAGG + Intronic
1133723914 16:8520160-8520182 CATCAAAAGTTGAGGATGAAAGG - Intergenic
1139031581 16:62888658-62888680 ACTGAGAAGGTGAGGAGGAAGGG - Intergenic
1140652237 16:77100665-77100687 CCTGACGATCTGAGGTGGAACGG + Intergenic
1140692697 16:77499489-77499511 CCTGACAGGCTGAGCAGGGACGG + Intergenic
1143852516 17:9823346-9823368 GCTGCCAAGCAGAGGAGGAAGGG - Intronic
1143960226 17:10711061-10711083 CCTGACAAAATGATGTTGAAAGG + Exonic
1146087840 17:29846490-29846512 GATGACAAACTGAGGGTGAAAGG - Intronic
1147366420 17:39962511-39962533 GCTGACAAGCCCAGGATGGAGGG + Intergenic
1147877613 17:43632598-43632620 CGGGAGCAGCTGAGGATGAAAGG + Intergenic
1148742794 17:49902208-49902230 CCCGCCAAGCTGCTGATGAAAGG + Intergenic
1152514693 17:80816485-80816507 CCAGGCAAGCCGAGGGTGAAGGG + Intronic
1153286239 18:3457404-3457426 CCTGACATGCTGAGAAAGGATGG + Exonic
1154396499 18:13995359-13995381 CCTGGGAAGCTAAGGATAAATGG + Intergenic
1158014736 18:52770946-52770968 CCTCACATGCTGAGGAAGACGGG + Intronic
1160137562 18:76285552-76285574 CATGACAAGTTGAGGCTCAAAGG + Intergenic
1160418409 18:78727639-78727661 CCTGACATGCTGAGGACAACAGG + Intergenic
1161057384 19:2197512-2197534 GCTGACAAGATGAGGCAGAAGGG - Intronic
1161899179 19:7105089-7105111 CCTGACAGGCTGAGAAAGCAAGG - Intergenic
1163298603 19:16429150-16429172 CCTGCCCAGCTGAGAATGCAAGG - Intronic
1164927455 19:32141205-32141227 ACTGAACTGCTGAGGATGAAGGG - Intergenic
1166130506 19:40743037-40743059 CCTAAAGAGCTGAGGATGACCGG - Intronic
1166908946 19:46137255-46137277 CCTGACATGCTGAGAAAGGATGG - Intergenic
1167055453 19:47108613-47108635 CCTGGCAAGTTAAAGATGAACGG - Intronic
1168055805 19:53864547-53864569 CCTGCCCAGCCCAGGATGAAAGG - Intergenic
925359021 2:3264426-3264448 CATGGCAAGCTGAAGATGATTGG - Intronic
925527676 2:4821584-4821606 CTTTACTATCTGAGGATGAAAGG + Intergenic
926174452 2:10577250-10577272 CCTGACCCTCTGAGGATGTAGGG - Intronic
926222951 2:10948323-10948345 CCCGTCAAGCAGAGGACGAAGGG + Intergenic
926772670 2:16392356-16392378 CCTGACAAGCTGATGGACAAGGG + Intergenic
926888321 2:17617760-17617782 CCTGACAAGCTGAGGATGAACGG - Intronic
928634510 2:33229364-33229386 ACTGAGAAGCTGAGGCAGAAGGG + Intronic
929805237 2:45139070-45139092 CTTGAGGAGCTAAGGATGAATGG - Intergenic
933780000 2:85794855-85794877 GCAGACAAGCTGGGGATTAATGG + Intergenic
937260109 2:120579997-120580019 CCTCACAAGCTGTGGATGAAGGG - Intergenic
937276218 2:120685772-120685794 CTTGAGAAGCTGAGGCTGCAGGG - Intergenic
937701638 2:124868928-124868950 CCTGAAAAAGTGAGAATGAATGG + Intronic
941080891 2:161059318-161059340 GCTGACCAGGTGAGGATGCAAGG - Intergenic
941327462 2:164134606-164134628 TCAAACAAGCTGGGGATGAAAGG + Intergenic
942326137 2:174778594-174778616 CCTAACACGCTGAAGATGAAAGG + Intergenic
947384469 2:229577323-229577345 CCTGACATTATGAGAATGAAAGG + Intronic
947713390 2:232328365-232328387 CCTGAGATGCAGAGGAAGAAGGG - Intronic
1169655138 20:7914411-7914433 ACTGACAGGCTGAGAAAGAAAGG + Exonic
1170084576 20:12514575-12514597 CCTGACAGGCTGCTGATGCAAGG + Intergenic
1171057089 20:21917852-21917874 CTTGATGAACTGAGGATGAAGGG + Intergenic
1175549790 20:59809798-59809820 GTAGACAATCTGAGGATGAAGGG + Intronic
1178396335 21:32246815-32246837 GCAGACAAGCTGATGATGGAGGG + Intergenic
1179286734 21:39983914-39983936 CCTCTGAAGCTGAGGCTGAAAGG + Intergenic
1180915662 22:19484673-19484695 AATGTCAGGCTGAGGATGAAGGG - Intronic
1181634444 22:24168069-24168091 CCTCACAAGCTGAGGCTGGCAGG - Intronic
1182431822 22:30303496-30303518 CCAGAGAAGCTGAGGCTGAGAGG + Intronic
1182855668 22:33515802-33515824 CCTGACAAGATCAGGATGAGAGG + Intronic
951266596 3:20575126-20575148 CCTGACATGCTGAGGAGAACTGG + Intergenic
952334798 3:32394393-32394415 CATGAGAAGCTGAGGACAAAAGG - Intronic
955790828 3:62587458-62587480 CCAGACCAGCTCAGGATGGAGGG - Intronic
958885106 3:99717325-99717347 CCTGCCAAGCATAGGCTGAAAGG - Intronic
959163541 3:102747577-102747599 CCTCACAAGCTGAAAATTAATGG - Intergenic
959885474 3:111494289-111494311 CCTTACAAGCTAAAAATGAATGG - Intronic
960864983 3:122190374-122190396 TCTCAAAAGATGAGGATGAATGG - Intronic
962266980 3:133950810-133950832 CCTGAAAAACTGAGTAGGAAGGG - Intronic
965031339 3:163371785-163371807 TCTAACAAGCTGAGGAAGATGGG + Intergenic
965036777 3:163450140-163450162 CCTGAGTAGCTGAGGATTACAGG - Intergenic
965395571 3:168157188-168157210 GCTCACAGGCTGATGATGAAAGG - Intergenic
968658469 4:1788797-1788819 CCTGGCAGGCTGAGGAAAAAGGG - Intergenic
976215176 4:82709278-82709300 TATGACAAGCCGAGGCTGAATGG - Intronic
976613393 4:87052335-87052357 CCTGAGAGGCTGAGGTTGTAGGG + Intronic
977488149 4:97675485-97675507 CCTGTCAAGCTGTGTATGATAGG - Intronic
982087893 4:151854692-151854714 CCAGAAAAGCAGAGGATGAAAGG + Intergenic
986221090 5:5769473-5769495 TCTGAGAAGCAGAAGATGAAGGG - Intergenic
988342152 5:29986427-29986449 CCTGGGAAGCAGAGGCTGAAGGG + Intergenic
991217260 5:64170055-64170077 CTTGACAGGTAGAGGATGAAGGG - Intronic
991612023 5:68459338-68459360 CCTTACAGACTGAGGATTAAAGG - Intergenic
993446432 5:88017821-88017843 CATGACAATCTGAGGTTAAATGG + Intergenic
996688047 5:126306122-126306144 CATGACAAGCAAAGGATGTAGGG - Intergenic
997653676 5:135539844-135539866 CCTGGCAGGATGAGAATGAACGG + Intergenic
997783713 5:136686151-136686173 CCTGAGAAGCTGGGTCTGAAGGG + Intergenic
1002616644 5:180460372-180460394 CCTCAGAAGCTCAGGGTGAACGG - Intergenic
1004479454 6:16004953-16004975 CCCGACAGGGTGAGAATGAATGG - Intergenic
1004825099 6:19411415-19411437 CCTGCCATGCTGGGGTTGAAGGG + Intergenic
1005045594 6:21639322-21639344 CCTGAGAAGATGAGACTGAAGGG - Intergenic
1005944110 6:30583403-30583425 CTAGACTAGCTGAGGATGCATGG + Intronic
1006805935 6:36789176-36789198 GCTGACAATCTCAGGAGGAAGGG + Intronic
1007700020 6:43761024-43761046 CCTGGAAAGCTGAGGAGGCATGG + Intergenic
1007912178 6:45527095-45527117 CCTGTCAAGATCAGGAGGAAGGG + Intronic
1009515508 6:64611051-64611073 CCTAAAAAGCAGAGGATGCATGG - Intronic
1011413371 6:87090016-87090038 TCTGAAATGCTGAGGATGAAAGG - Intronic
1012157225 6:95834594-95834616 CCTGAGAAGCTGAAGTTGAGAGG + Intergenic
1013850891 6:114514156-114514178 TCTGACAAACTGTGAATGAAAGG + Intergenic
1014035083 6:116757671-116757693 CCTGGCAGGCAGAGGATGCAGGG + Intronic
1014565817 6:122946558-122946580 CTTGAGAATCAGAGGATGAAAGG + Intergenic
1014648700 6:124008233-124008255 CCTGGCAGGCAGAGGAGGAAAGG - Intronic
1015161142 6:130153262-130153284 CCTTACAACCTGAAGATTAAGGG + Intronic
1016378062 6:143444300-143444322 CCTGCCATGCTGAGGATGAGTGG + Intronic
1018941370 6:168310503-168310525 CGTGACAAGCTCAGGAGGAGAGG - Intronic
1019757469 7:2783446-2783468 CCTCAGAGGGTGAGGATGAATGG - Intronic
1020352391 7:7235351-7235373 CCTCTCAAGCAGAGGTTGAATGG + Intronic
1021470906 7:21001664-21001686 CCTGTCTACCTGAGGATGAGAGG - Intergenic
1023042899 7:36187919-36187941 CCTGAGTAGCTGAGGATTACAGG + Intronic
1024310721 7:47966567-47966589 CCTGACAAGCACAGTGTGAATGG - Intronic
1024560494 7:50640895-50640917 CCGGCAAAGCTGAGGATGGAAGG - Intronic
1025957037 7:66190980-66191002 CCTGAGAAGCAGAGGTTGCAGGG - Intergenic
1028914429 7:96243087-96243109 CCTGAGAAGCTGGGGATTACAGG + Intronic
1030130973 7:106199906-106199928 CCTGACAACCTTAGGAGGTATGG + Intergenic
1030202066 7:106915824-106915846 TCTTTCTAGCTGAGGATGAATGG - Intergenic
1030284877 7:107815646-107815668 CCTGAAAGGTTGAGGATAAAAGG - Intergenic
1032188334 7:129746995-129747017 ACAGACAACCTGAGGAAGAATGG - Intronic
1032374636 7:131399367-131399389 CATGACAAGCTGGTGTTGAAGGG + Exonic
1033741817 7:144282064-144282086 CATGAGGAGGTGAGGATGAAAGG + Intergenic
1033752084 7:144367550-144367572 CATGAGGAGGTGAGGATGAAAGG - Intronic
1034831080 7:154308014-154308036 CCTCACAAGATGAGGATGTGAGG - Intronic
1034845669 7:154442478-154442500 CCTGGCAAAATGAAGATGAAGGG + Intronic
1035909917 8:3554995-3555017 CCACATAAGCTGAGGAGGAAGGG + Intronic
1041135730 8:54756735-54756757 CCTGACTACTTGAGGATAAATGG + Intergenic
1042014804 8:64296688-64296710 GTTTACCAGCTGAGGATGAAGGG + Intergenic
1045943367 8:107765364-107765386 ACAGACAAGCTGGGGATAAAGGG + Intergenic
1046613371 8:116449534-116449556 CCTGAGAAGTTCAGGAAGAAGGG - Intergenic
1048818623 8:138358407-138358429 ACTGACCAGCTGAGGATGTTTGG + Intronic
1049229233 8:141473485-141473507 CCTGACAAGGTGAGGAAGGGCGG + Intergenic
1054882440 9:70159092-70159114 CCTGGAAAGGTGAGGATGCAAGG + Intronic
1056856350 9:90132908-90132930 CTTGAGAAGCTGAGGATGTAGGG - Intergenic
1058040388 9:100295738-100295760 CTGGACAAGCTGAGCAGGAAAGG + Intronic
1058909035 9:109504325-109504347 CCTGTCCAGCTGAGACTGAAAGG - Intergenic
1060225189 9:121786152-121786174 CCTGAGATGCTGAAGATGCAGGG - Intergenic
1061386239 9:130291090-130291112 CCTGGAAAGCTGAAGAAGAAAGG - Intronic
1061802407 9:133119767-133119789 TCTGCCAAGCTCAGGAGGAAAGG + Intronic
1062659382 9:137620701-137620723 CCTGTTTAGCTGAGGAGGAAGGG + Intronic
1189503279 X:41584523-41584545 CCTGATAATCTGAGGTGGAACGG - Intronic
1196818824 X:119686641-119686663 CCTGCCAAACTGAGGAGGAAGGG + Intronic
1198617659 X:138477357-138477379 CCTGATAATCTGAGGTGGAACGG - Intergenic
1198752942 X:139953496-139953518 CCTGACAAGCTGATGAGGCCTGG - Intergenic
1199845887 X:151692988-151693010 CTTGTCAAGCTGAGGCTGGAGGG - Intergenic
1200253172 X:154564534-154564556 CCTGCCTAGCCCAGGATGAAGGG + Exonic
1200264595 X:154639881-154639903 CCTGCCTAGCCCAGGATGAAGGG - Intergenic
1200917337 Y:8582975-8582997 CCTGTCAGGCCCAGGATGAAAGG + Intergenic
1200919295 Y:8598899-8598921 ACTGTGAAGCTCAGGATGAAGGG + Intergenic
1200984401 Y:9290525-9290547 CCTGCAAGGCCGAGGATGAAGGG - Intergenic
1200985043 Y:9295126-9295148 CCTGTGAGGCCGAGGATGAAGGG - Intergenic
1202126040 Y:21569719-21569741 CCTGCAAGGCCGAGGATGAAGGG + Intergenic
1202129984 Y:21600780-21600802 CCTGCAAGGCTTAGGATGAAGGG - Intergenic
1202149845 Y:21834809-21834831 CCTGTGAGGCTCAGGATGAAGGG + Intergenic
1202179935 Y:22131099-22131121 CCTGCGAGGCTCAGGATGAAGGG - Intergenic
1202182768 Y:22153654-22153676 CCTCAGAGGCTCAGGATGAAGGG - Intergenic
1202208591 Y:22432747-22432769 CCTCAGAGGCTCAGGATGAAGGG + Intergenic
1202211426 Y:22455295-22455317 CCTGCGAGGCTCAGGATGAAGGG + Intergenic