ID: 926888815

View in Genome Browser
Species Human (GRCh38)
Location 2:17621733-17621755
Sequence CCCAGAAGGCAGAGACAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 656
Summary {0: 1, 1: 1, 2: 4, 3: 61, 4: 589}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926888815_926888821 -7 Left 926888815 2:17621733-17621755 CCCTCTTGTCTCTGCCTTCTGGG 0: 1
1: 1
2: 4
3: 61
4: 589
Right 926888821 2:17621749-17621771 TTCTGGGTAGCTGGGATTATAGG 0: 6
1: 384
2: 9342
3: 78460
4: 171646
926888815_926888822 12 Left 926888815 2:17621733-17621755 CCCTCTTGTCTCTGCCTTCTGGG 0: 1
1: 1
2: 4
3: 61
4: 589
Right 926888822 2:17621768-17621790 TAGGCACTTGCCACCACACTTGG 0: 2
1: 76
2: 1093
3: 8340
4: 30679

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926888815 Original CRISPR CCCAGAAGGCAGAGACAAGA GGG (reversed) Intronic
900191269 1:1353308-1353330 CCCAGCGGGCAGAGCCCAGAAGG + Exonic
900660888 1:3782850-3782872 CTCAGGAGGCTGAGACAGGAGGG + Intronic
900913743 1:5620171-5620193 ACTTGAAGGCAGAAACAAGAAGG + Intergenic
901105268 1:6750934-6750956 CTCAGAAGGCTGAGGCAGGAGGG - Intergenic
901152232 1:7111493-7111515 CACAGATGGCAGAGTTAAGATGG - Intronic
901501790 1:9657052-9657074 CCCAGAAGGAAGAGCAAAGCAGG - Intronic
901756493 1:11444552-11444574 CCAAGGAGGCAGAGAGAGGAAGG - Intergenic
902170004 1:14602316-14602338 TGCAGGAGGGAGAGACAAGATGG - Intronic
902628848 1:17692808-17692830 CACAGAAGGCAGACTCCAGATGG - Intronic
902752145 1:18524142-18524164 CACAGCAGGCAGAGGCCAGAAGG - Intergenic
903221291 1:21870964-21870986 CCCAGAAGGGAGAGGGGAGAAGG + Intronic
903777964 1:25805345-25805367 CACAGAGGGCAGAGGAAAGATGG - Intronic
903886574 1:26544337-26544359 CCCAACAGGCAGAGACAGAAGGG - Intronic
903967418 1:27099393-27099415 CCCAGCAGGCAGAGAGACGTGGG + Exonic
904020147 1:27457726-27457748 CTCAGGAGGCTGAGGCAAGAGGG - Intronic
904032177 1:27540118-27540140 CACAGAAGGTAGAGCCAGGAAGG - Intronic
904809884 1:33156559-33156581 CCTAGAAGTCAGGGACAAGAGGG - Intronic
904931093 1:34088023-34088045 CCCAGAGGGGAAAGAGAAGAGGG + Intronic
905046528 1:35007727-35007749 CCCAGGAGGCAGAGGCTACAGGG + Intronic
905282734 1:36859526-36859548 CCGAGAAGGCAGAAAGAAGAAGG - Intronic
905481547 1:38265352-38265374 CCCAGAAGGCATAGCCAGGGAGG - Intergenic
905567821 1:38979936-38979958 CCCAAGAGACAGAGACAAAAAGG - Intergenic
905715422 1:40145432-40145454 CCCAAAGGGCAGAGGAAAGAAGG + Intergenic
906037640 1:42762161-42762183 CTCAGGAGGCCGAGACTAGAGGG + Intronic
906366512 1:45214653-45214675 ACCAGAAGGCAATGACCAGAGGG - Intronic
906613269 1:47218173-47218195 CCTCGAAGGCAGAGCCTAGAGGG + Exonic
906970420 1:50507666-50507688 GCTAGAAGGCAGTGACATGATGG - Intronic
907358106 1:53893004-53893026 CCCAGAAGCCAGAGACAGCATGG - Intronic
907542078 1:55224865-55224887 CTCAGGAGGCTGAGACAGGAGGG + Intergenic
908163581 1:61435890-61435912 CCAAGCATTCAGAGACAAGAGGG - Intronic
908539408 1:65108433-65108455 CTCAGAAGGCTGAGGCTAGAGGG + Intergenic
909895828 1:81067700-81067722 AACAGAAGGCAGAAACAAGAGGG + Intergenic
910188446 1:84570943-84570965 GCCTGGAGGCAGAGACAACATGG + Intronic
910254504 1:85234447-85234469 CTCAGGAGGCTGAGGCAAGAGGG - Intergenic
910538435 1:88326800-88326822 CACAGAAGCCAGAAACAAGTTGG - Intergenic
910702522 1:90091625-90091647 CCAAGAAGGAAGAGAAGAGATGG + Intergenic
910980673 1:92957657-92957679 AGCAAAAGGCAGAGAGAAGAAGG + Intronic
911098502 1:94075630-94075652 CTCACAAGTCTGAGACAAGAGGG + Intronic
911271946 1:95812574-95812596 CCCAGAAGGCAGAGATTGCAGGG + Intergenic
911279382 1:95903717-95903739 CCCACAAGCCAGAGGAAAGATGG - Intergenic
912450300 1:109764131-109764153 CCTAAAAGGCAGAGGGAAGAGGG - Intronic
913316284 1:117555838-117555860 ACAAGAATCCAGAGACAAGAAGG + Intergenic
913530893 1:119733544-119733566 CCCAGGAGTCAGAGACTAGCTGG - Intronic
913531892 1:119739387-119739409 CCAAGGAGTCACAGACAAGAAGG - Intronic
913696267 1:121328776-121328798 CCCAGGAGGCTGAGACGGGAAGG + Intronic
914141297 1:144951282-144951304 CCCAGGAGGCTGAGACGGGAAGG - Intronic
915065188 1:153219100-153219122 ACCAGAAGGGAAAGATAAGATGG + Exonic
915262072 1:154684174-154684196 GGCAGAAGGCAGAGAGGAGAAGG + Intergenic
915492709 1:156260187-156260209 TACAGAAGGCAGAGAAAGGAAGG + Intronic
915814582 1:158952737-158952759 CCCAGAGGGAGGAGCCAAGATGG + Intronic
917019167 1:170567784-170567806 CACAGAAGGCCCAGACAAGTTGG + Intergenic
917725184 1:177821176-177821198 CACAGCAGGCAGAGCCAAGTGGG + Intergenic
918318065 1:183339798-183339820 CTCAGAAGGCAGAGATAAAAAGG - Intronic
918374567 1:183896291-183896313 CTCAGAAGGCTGAGGCAGGAGGG - Intronic
918473293 1:184897369-184897391 CCCAGAAGGCAAATAAAAAAGGG - Intronic
920483590 1:206347141-206347163 CCCAGGAGGCTGAGACGGGAAGG + Intronic
920649710 1:207827654-207827676 CCCAGCAGGCAGAGCCAGGAGGG - Intergenic
921039515 1:211416604-211416626 CCCTGAAGCCCGAGACAGGACGG - Intergenic
921048313 1:211492762-211492784 ACCAGAGAGCAGAGACAGGAAGG - Exonic
921292445 1:213671036-213671058 ACCAGAAAGCACAGAAAAGAAGG + Intergenic
921485264 1:215708066-215708088 CCCAGAAGACAGTGGGAAGAAGG + Intronic
921685036 1:218080427-218080449 CCAAAAAGGCACAGACTAGATGG + Intergenic
922275067 1:224069961-224069983 TCCAGGAGGCTGAGGCAAGAGGG - Intergenic
922517903 1:226222427-226222449 TCTAGAATGCAGAGACAGGACGG + Intergenic
922639239 1:227210387-227210409 CCCAAAAGGTAGAGAGAATAAGG - Intronic
922737652 1:227996910-227996932 TCAAGAAGGCAGAGGAAAGATGG + Intergenic
923959448 1:239060197-239060219 TCAAGAAGGCAGAAACGAGATGG - Intergenic
1063084355 10:2801886-2801908 CGCATGAGGCAGACACAAGAAGG - Intergenic
1063301161 10:4850081-4850103 CTCAGAATGAACAGACAAGAGGG - Intergenic
1063986471 10:11509282-11509304 TGCAGAAGGCAGAGAAGAGATGG + Intronic
1066167839 10:32807804-32807826 CCCAGGAGGCAGAGGAAAAAAGG - Intronic
1067747142 10:48944359-48944381 CCCAGCAGGCAGGGAAAGGATGG + Intronic
1068140426 10:52999623-52999645 CCCAGAAGGAAAATACAAGAAGG + Intergenic
1068725605 10:60298706-60298728 GACAGGAGGCAGAAACAAGATGG + Intronic
1068887243 10:62110324-62110346 CCCAGAAGAATGAGAGAAGAAGG + Intergenic
1068963694 10:62890805-62890827 CCCAGAAGGCATAGACAAGAAGG + Intronic
1069647556 10:70014008-70014030 CTCAGGAGGCTGAGGCAAGAGGG + Intergenic
1069809910 10:71150694-71150716 ACCTGAAGTCAGAGTCAAGAGGG + Intergenic
1070165032 10:73890932-73890954 CCCAGAAGTTTGAGACAAGCTGG + Intergenic
1070236794 10:74635978-74636000 CTCAGAAGGCTGAGGCAAGGAGG + Intronic
1070754410 10:78982695-78982717 CTCAGAAGGCAAAGCCAACAGGG - Intergenic
1071679509 10:87690589-87690611 TCCAGAAGCCAGAGAGAACAGGG + Intronic
1071682937 10:87725801-87725823 CTCAGGAGGCTGAGGCAAGAGGG - Intronic
1071830887 10:89370940-89370962 CCCAGGAGGCAGAGACTGCAGGG + Intronic
1072131730 10:92500545-92500567 ATCAGAAGGCAGAGAGAAAAGGG + Intronic
1072629423 10:97135178-97135200 CCCAGCAGGCACAGCCAAGCAGG + Intronic
1072732841 10:97859324-97859346 CCCAGCATGCAGAGACAAGCTGG - Intronic
1072908570 10:99479270-99479292 CTCAGAAGGCTGAGACAGGAGGG - Intergenic
1072981065 10:100097971-100097993 TCAAGAAGGCAGAACCAAGAGGG - Intergenic
1073409237 10:103325913-103325935 CTCAGGAGGCTGAGACAGGAGGG + Intronic
1074446987 10:113528773-113528795 CTCAGGAGGCTGAGACAGGAGGG + Intergenic
1075003789 10:118816494-118816516 CCCAGACATCAGACACAAGAGGG - Intergenic
1075046531 10:119150559-119150581 CTCAGAAGGCTGAGGCAGGAGGG + Intronic
1075599781 10:123758962-123758984 CACTGAAGGCAGAGGCAAAATGG + Intronic
1075743726 10:124711953-124711975 CTCAGAAGTCTGAGGCAAGATGG + Intronic
1076586936 10:131555738-131555760 CCCTGAGGAGAGAGACAAGATGG + Intergenic
1076637608 10:131892404-131892426 CCCGGGAGGCAGTGACCAGAGGG + Intergenic
1076680241 10:132167988-132168010 ACCAGAAAGCAGGGACAAAATGG + Exonic
1076712567 10:132346598-132346620 CCCGGGAGGCGGAGCCAAGATGG + Intronic
1076991542 11:278631-278653 CCCAGAGGGCTGAGACCAGCCGG - Intronic
1077183950 11:1228283-1228305 CCCAGGAGGCGGAGCCAAGGAGG - Intronic
1077519486 11:3023500-3023522 CTCAGAAGGCTGAGGTAAGAGGG - Intronic
1078759984 11:14244058-14244080 CCCAGAAGGCAGAATCCACAGGG - Intronic
1079088094 11:17461539-17461561 ACCAGAAGGCAGTGAATAGATGG + Intronic
1079201909 11:18383802-18383824 CCCAGGAGTCAGAGACTAGAGGG + Intergenic
1080437557 11:32260009-32260031 ACCAGAAGGCAGAGACGACTGGG + Intergenic
1080897930 11:36461664-36461686 CCAAGGAGGCAGACACAGGAAGG - Intronic
1081782109 11:45720350-45720372 AGAAGAAGGCAGAGACAAGATGG - Intergenic
1082067375 11:47911604-47911626 CCAAGAAGGCAGAGCCTGGAGGG + Intergenic
1082092873 11:48104156-48104178 TCCAAAAGGCAGAGACAAGCAGG - Intronic
1082739233 11:56892037-56892059 CCCAGAAATCAGAGAGCAGAGGG + Intergenic
1083597396 11:63924789-63924811 CTCAGGAGGCTGAGACAGGAGGG - Intergenic
1083758480 11:64803433-64803455 GCCAGAAGACAGAGGGAAGAGGG + Intergenic
1084090352 11:66875547-66875569 CCGAGGAGGAAGAGCCAAGAAGG + Intronic
1084627756 11:70321749-70321771 CCCAGATGACAGGGACAAGATGG + Intronic
1084742296 11:71147506-71147528 CCCAGAGGGCGGACACAAGTCGG + Intronic
1084838269 11:71822273-71822295 CCCAGGAGGCAGAGATTACAGGG + Intergenic
1085219789 11:74864340-74864362 GCAAAAAGGCAGAGAGAAGATGG + Intronic
1085457611 11:76674133-76674155 CCTAGAAGGCAGGGCCCAGAAGG - Intergenic
1085484981 11:76855377-76855399 CTCAGAAGGCTGGGACGAGAGGG - Intergenic
1085699479 11:78733446-78733468 CCCACAAGCCTGAAACAAGAGGG - Intronic
1086872004 11:92049146-92049168 CCCACAGGGCAGAAACAAGAAGG - Intergenic
1086959210 11:92965500-92965522 CCCAGAAGGCTGAGGCAGGAGGG - Intergenic
1086983256 11:93221760-93221782 CCCAGAATGCTGTGACAAGTGGG - Intergenic
1088184174 11:107145675-107145697 CCCAGAAGGGAGAGAAGAAAAGG - Intergenic
1088423184 11:109670909-109670931 CCCAGAAGGCAGAGATAGCAAGG + Intergenic
1088631525 11:111778458-111778480 CCCAGAAAGCAGGGCCCAGAGGG + Intergenic
1089195983 11:116694346-116694368 CCAAGAGGGCAGATCCAAGAGGG + Intergenic
1089196001 11:116694423-116694445 CCAAGAGGGCAGAGCCAAGAGGG + Intergenic
1089203044 11:116736574-116736596 CTCAGGAGGCTGAGGCAAGAAGG + Intergenic
1089408077 11:118215455-118215477 CTCAGGAGGCTGAGACAGGAAGG - Intronic
1089702258 11:120252539-120252561 CACAGAAAGCAGAAACAAGGTGG - Intronic
1089899426 11:121965426-121965448 CCCAGAAGGAGAAGATAAGAAGG - Intergenic
1090206662 11:124887939-124887961 CCCTGAACCCAGAGAAAAGAGGG + Intronic
1091177561 11:133575455-133575477 CCCAGGGAGCAGGGACAAGAAGG - Intergenic
1091257116 11:134198386-134198408 CCCAAAAGGCAGGGACAAGGTGG - Intronic
1091379423 12:46369-46391 CCAAGGAGGTAAAGACAAGAGGG - Intergenic
1092196852 12:6554995-6555017 CCTGGATGGCAGAGACAAGCCGG + Intronic
1092377542 12:7968307-7968329 CTCTGAAGGCAGAGGCAGGAAGG + Intergenic
1092515279 12:9204987-9205009 CTCAGGAGGCTGAGGCAAGAAGG + Intronic
1093150646 12:15617095-15617117 CTCAGGAGGCTGAGACAGGAGGG - Intergenic
1093996138 12:25644840-25644862 CAGGGAAGGCAGAGACAATATGG + Intronic
1095190935 12:39257310-39257332 CCCTGAAGGCAGAGCTCAGAAGG + Intergenic
1095997992 12:48105777-48105799 CCCAGGAGAGAGAGACCAGAAGG + Exonic
1096416293 12:51417281-51417303 CTCAGAAGGCTGAGGCAGGAGGG - Intronic
1096616741 12:52837395-52837417 CCAAGAAGACAAAGAAAAGAAGG + Intergenic
1097431560 12:59514851-59514873 GCCAGAAGGAAGAGAAAAGAGGG + Intergenic
1097776985 12:63658416-63658438 CCCAGGAGGCAGAGGCTACAGGG + Intronic
1097903600 12:64897802-64897824 CCTAGAAGTCAGAGACAGCAAGG - Intergenic
1098572391 12:72003088-72003110 CCAGGTAGGCAAAGACAAGAGGG - Intronic
1099252442 12:80272811-80272833 CATAGGAGGCAGAGACAAGAAGG + Intronic
1099341318 12:81438390-81438412 CCCAGCAGGCAGAGAGAGGTTGG + Intronic
1099971715 12:89507058-89507080 CCCAGAAGTCTGAGACCAGCTGG + Intronic
1100102591 12:91126962-91126984 ACAAGAAGGCAGAGAAAGGAGGG - Intergenic
1100229987 12:92597296-92597318 CTCAGGTGGTAGAGACAAGAAGG - Intergenic
1100331903 12:93590717-93590739 CCCAGCAGGCAGAGCCGAGATGG + Intergenic
1100357873 12:93849050-93849072 AACAGAAGCCAGAGCCAAGAGGG - Intronic
1100379855 12:94051398-94051420 CTCAGAAGGCTGAGATAAGGAGG - Intergenic
1100862392 12:98820164-98820186 CCCAGTTTGCAGAGACAATATGG + Intronic
1100927438 12:99565604-99565626 CTCAGAGGGCAGAACCAAGAAGG - Intronic
1102109022 12:110349889-110349911 CCCACAGGGCAGGGACAGGAAGG + Intronic
1102163507 12:110787940-110787962 CCCATAACGCAGAGGAAAGAAGG - Intergenic
1102469135 12:113149728-113149750 CCCAGAAGGCAGCCACCAGCAGG - Intergenic
1102904254 12:116662278-116662300 CCGAGGTGGCAGAGAGAAGAGGG - Intergenic
1103826268 12:123741546-123741568 CTCAGGAGGCTGAGACGAGACGG - Intronic
1104048558 12:125181334-125181356 CCAAGAAGGAAGAGGGAAGAGGG + Intergenic
1105285130 13:18997120-18997142 GCCAGAAGGCAGAAAAATGAAGG + Intergenic
1105426399 13:20298408-20298430 CCCAGAAGCAACAGGCAAGAGGG + Intergenic
1105956810 13:25291150-25291172 CTCAGAAGGCTGAGACAGGAAGG - Intergenic
1105958022 13:25301954-25301976 GCCAGAGGGAAGAGACAGGATGG - Intronic
1106013532 13:25847085-25847107 CCCAGATGGCAGAGGCCACATGG - Intronic
1106044296 13:26123439-26123461 GCCAGAAGGCAGAGATAAAAGGG + Intergenic
1106636291 13:31531850-31531872 CCCAGAAGGCAGAAAATAGATGG - Intergenic
1106897528 13:34320714-34320736 CCCAGAATGAAGAAACTAGAGGG - Intergenic
1107430261 13:40334182-40334204 CGAAGGTGGCAGAGACAAGAAGG + Intergenic
1107731834 13:43356463-43356485 CCTAGAAGCCAGGGAGAAGAAGG - Intronic
1107765078 13:43725857-43725879 CTCAGGAGGCTGAGACAGGAGGG + Intronic
1108386368 13:49903030-49903052 CTCAGAAGGCTGAGGCAGGAGGG - Intergenic
1109077833 13:57860768-57860790 ACCAGAAGCCAGAGACAGTAAGG - Intergenic
1110133912 13:72042190-72042212 CTCAGAAGGCTGAGGCAGGAGGG - Intergenic
1110566809 13:76965477-76965499 CATGGAAGGAAGAGACAAGAGGG - Intergenic
1110722752 13:78783376-78783398 TCAAGAAGACAGAGACAAGGAGG - Intergenic
1111722377 13:91962972-91962994 CCCAGAAGGCAGAAATAATAAGG - Intronic
1112404860 13:99110202-99110224 CTCAGAAGGCTGAGACAGGTGGG + Intergenic
1112994104 13:105551440-105551462 CTCAGGAGGCTGAGGCAAGAAGG + Intergenic
1114061025 14:19015913-19015935 CACAGAAGGCAGAGTCCCGAGGG - Intergenic
1114101231 14:19384066-19384088 CACAGAAGGCAGAGTCCCGAGGG + Intergenic
1114235452 14:20819777-20819799 CTCAGGAGGCTGAGACAGGAGGG + Intergenic
1115301980 14:31894754-31894776 ACCAGAAGCCAGAGAGTAGAAGG - Intergenic
1115434971 14:33362266-33362288 CACAGAAGGCAGAGTGATGAGGG + Intronic
1115997708 14:39211340-39211362 CTCAGGAGGCTGAGACAGGAGGG - Intergenic
1116738501 14:48725652-48725674 TCCAGAAGGCGGAGACGACATGG + Intergenic
1116881780 14:50177781-50177803 TACAGAAGGCAGGGAGAAGATGG + Intronic
1117637049 14:57754806-57754828 ACCAGGAGGCAGAGACACGTAGG + Intronic
1117798848 14:59422907-59422929 CCCAGAAGTCAGGGACCATAAGG + Intergenic
1117837746 14:59825291-59825313 CCCAGAGGTCAGATACAAGATGG - Intronic
1118213364 14:63786298-63786320 CTCAGGAGGCTGAGGCAAGAGGG + Intergenic
1118508203 14:66440028-66440050 CCCAGAAGGAGAAAACAAGAAGG - Intergenic
1118753158 14:68821008-68821030 CCCAGACGGCAGTGCCAGGATGG - Intergenic
1119598530 14:75958474-75958496 CCCAGAGGGCAGACAGGAGAGGG + Exonic
1119874345 14:78044769-78044791 TCCAGAAGGCATATACATGAAGG + Intergenic
1121767402 14:96499960-96499982 CTCAGAAGGCAGTGAAGAGAGGG - Intergenic
1121770706 14:96534378-96534400 CCAAGAAGGCAGAATGAAGAAGG + Intronic
1121775776 14:96589663-96589685 CTCAGAAGGCAGCTGCAAGAGGG + Intergenic
1121777327 14:96599190-96599212 CTCTGAAGGCAGAGCCAAGAGGG + Intergenic
1121801499 14:96777943-96777965 CCCAGAAGGAAGATAGCAGAGGG - Intergenic
1122809530 14:104281186-104281208 CCCAGCAGGCAGAGCCAGCATGG + Intergenic
1123700540 15:22911618-22911640 CCCAGCAGACAGGGCCAAGAAGG + Intronic
1123914505 15:25008865-25008887 CTCAGAAGGCTGAGGCAAGAGGG - Intergenic
1125008295 15:34842451-34842473 TCAAGAAGCCAGAGAGAAGAGGG + Intergenic
1125080657 15:35669134-35669156 GTTAAAAGGCAGAGACAAGAAGG - Intergenic
1126120093 15:45243783-45243805 CCCAGAAAGAAGAGATAAAAGGG + Intergenic
1126121873 15:45260652-45260674 CTCAGAAGGCTGAGGCAGGAGGG + Intronic
1126442187 15:48701507-48701529 CCTAGAAGGCAGGGACAATGTGG - Intergenic
1126764108 15:51996283-51996305 CCTAGAATCCAGAGACAAGCAGG - Intronic
1126765956 15:52011300-52011322 CTCAGGAGGCTGAGACAGGAGGG - Intronic
1126771165 15:52057431-52057453 CCCAGAAGACAGAGGCAGGTTGG - Intronic
1127530444 15:59838504-59838526 CCCAGAAAGCAGACCCGAGAAGG - Intergenic
1128259338 15:66221570-66221592 CTTAGAAGGCAGAGAGAAGTGGG + Intronic
1128555261 15:68627470-68627492 TCCAGGATGCAGAGAGAAGAGGG + Intronic
1128774715 15:70311382-70311404 CCAGGAAGGAAGAGACACGAGGG - Intergenic
1129327050 15:74805918-74805940 CCCAGAAGGCACAGAGATGGAGG + Intergenic
1129764635 15:78154619-78154641 CTCAGGAGGCTGAGGCAAGAGGG + Intronic
1130088823 15:80802241-80802263 CCCAGGAGGCAGACACCATAAGG + Intronic
1130399674 15:83537780-83537802 CCTAGAAGACAGAGAGCAGATGG - Intronic
1130682283 15:86007175-86007197 CTCAGAAGGCTGAGGCAGGAGGG - Intergenic
1132011411 15:98279818-98279840 CCCAGAAGCCAGATACAAATGGG - Intergenic
1132203425 15:99970578-99970600 CTCAGGAGGCTGAGGCAAGAAGG - Intergenic
1132313826 15:100876909-100876931 CCCGCAAGCCAGAGACAAGTGGG + Intergenic
1132399137 15:101494620-101494642 AGCAGAAGGCAGAGCCCAGAAGG - Intronic
1132791277 16:1690101-1690123 CCCAGAGTGCAGCGACAAGGAGG - Intronic
1133307137 16:4817507-4817529 CGCAGAACGCTGAGACAACAGGG + Intronic
1135109576 16:19680354-19680376 CCCAGGAGCCAGAGACAGGGCGG + Intronic
1135386805 16:22049306-22049328 CTCAGAAGGCTGAGGCAAGAAGG - Intronic
1135435813 16:22425935-22425957 CCCAGGCTGCAGGGACAAGAGGG + Intronic
1136028547 16:27485926-27485948 CCCGGAAGGCTCAGACAGGAAGG + Intronic
1136041600 16:27583855-27583877 CAAAGAAGGCAGAGTCAAGAGGG - Intronic
1136372921 16:29847431-29847453 CCAGGAAGGCAGAGCCAAGGCGG + Intronic
1136461925 16:30416840-30416862 CTCAGAAGGCTGAGTCAGGAGGG + Intronic
1136516089 16:30769158-30769180 GCAAGTGGGCAGAGACAAGATGG - Intronic
1136559134 16:31028361-31028383 CCCAGAAGACGGAGAGCAGAAGG + Intergenic
1137235991 16:46618747-46618769 CTCAGGAGGCTGAGACAGGAGGG - Intronic
1137704957 16:50528595-50528617 GCAAGAAGGCAGGGAGAAGATGG + Intergenic
1138457661 16:57130734-57130756 CCATTATGGCAGAGACAAGATGG + Intronic
1139515208 16:67448770-67448792 CCCAGAAGGCTCAGACCAGGTGG - Intronic
1139581279 16:67875240-67875262 CACAGAAGGCAGGGACATAAAGG - Intronic
1139591009 16:67932946-67932968 CTCAGAAGGCTGAGGCAGGAGGG + Intronic
1139796624 16:69488028-69488050 CTCAGAAGGCTGAGACAGGAGGG - Intergenic
1141592852 16:85080096-85080118 CCCAGAGGGCAGAGGGCAGAGGG + Intronic
1141774101 16:86110845-86110867 CCCAGAAGTGAGAGACATGGGGG - Intergenic
1143019246 17:3908125-3908147 CCCAGGAGGCAGAGCACAGAGGG + Intronic
1143164066 17:4889212-4889234 CACAGAAAGCACAGAAAAGAGGG - Intronic
1143188579 17:5024868-5024890 CCCTGAAGGAAGAGACAGGAGGG - Exonic
1143361979 17:6379056-6379078 CTCAGATGGCAGAGCCACGATGG + Intergenic
1144125418 17:12198304-12198326 CTCAGAAGGCAGAGCGAAGCTGG - Intergenic
1144452581 17:15393397-15393419 CACAGAAAGAAGAGAAAAGAGGG - Intergenic
1145028889 17:19489620-19489642 CCCAGAGGCCAGAGACAGGAGGG - Intergenic
1147212129 17:38877840-38877862 CCCAGGAGGAAGAGACAGGCAGG - Intronic
1147282296 17:39371951-39371973 AACAGAAGGCAGGGATAAGATGG - Intronic
1147934136 17:44001815-44001837 CAAAGAGGACAGAGACAAGAAGG + Intronic
1147942997 17:44063150-44063172 CTCAGAAGGCCGAGGCAGGAGGG + Intronic
1148488040 17:48003822-48003844 GACAGATGGCAGGGACAAGAGGG - Intergenic
1148700401 17:49583337-49583359 CCCGCCAGGCAGAGGCAAGATGG + Intronic
1149481294 17:57005466-57005488 CCCAGGAGGCACAGGCAAGGTGG - Intronic
1149769185 17:59306605-59306627 CTTAGGAGGCAGAGACAGGAGGG + Intergenic
1150389530 17:64782191-64782213 CCCAGGAGGTGGAGTCAAGAGGG - Intergenic
1150843410 17:68631162-68631184 ACCAGAAGGCAGAGATCACAAGG - Intergenic
1151183340 17:72345533-72345555 CCAGGAAGGCAGAAAGAAGAGGG + Intergenic
1151508850 17:74546113-74546135 TGCAGAAGGCAGAGCCAAGCTGG + Exonic
1152274377 17:79347323-79347345 CCCAAAAAGAAGAGATAAGAGGG - Intronic
1152305257 17:79516616-79516638 CCCAGATGGTAGAGACGGGATGG + Intergenic
1152343517 17:79738071-79738093 CCCAGAAGGCAGAGGCGGGAGGG + Intronic
1152490517 17:80629787-80629809 CCCAGAAGAGAGAGACACAATGG - Intronic
1153579977 18:6562963-6562985 CCCAGAAGGCAGAGGCTGCAGGG + Intronic
1154021135 18:10664997-10665019 GCCAGAAGGCATAGAGAAAAGGG - Intergenic
1154108069 18:11541613-11541635 GCCAAAAGGAAGAGACAATAAGG + Intergenic
1154124842 18:11681914-11681936 CCCAGGAGGCTGAGGCAAGAGGG + Intergenic
1155248216 18:23931412-23931434 CTAAGAAGGCTGAGGCAAGAGGG + Intronic
1155495166 18:26435754-26435776 CCCAGAAGGAACAGCAAAGAAGG - Intergenic
1155837381 18:30602987-30603009 TCCAGAGTGCAGAGAAAAGAGGG - Intergenic
1156100795 18:33592532-33592554 CGCAGAAGCCGGTGACAAGATGG + Intronic
1157036445 18:43980418-43980440 CACAGAAGGCAGAGATTACAAGG - Intergenic
1157500921 18:48190099-48190121 CACCCAAGGCAGAGAGAAGAGGG - Intronic
1158137766 18:54224754-54224776 CCGAGAAGGCGGAGACAAGATGG - Exonic
1158221106 18:55151675-55151697 CCCCAAAGTCAGAGACTAGATGG + Intergenic
1158554760 18:58466116-58466138 CCCAGAGGGGAGACACAGGAGGG + Intergenic
1159190740 18:65038611-65038633 CCCTTGAGGCAGACACAAGAGGG + Intergenic
1161511827 19:4676296-4676318 CCCAGAAGGCGGGGAGAGGAGGG + Exonic
1161788426 19:6343300-6343322 CCCAGAAGGCTCAGGCAAGTGGG + Intergenic
1161924070 19:7288256-7288278 CCCAGGAGGCGGAGGCAAGCAGG + Intronic
1162429323 19:10617879-10617901 GCCAGAAGGCAGAGAGACAAGGG - Intronic
1162623842 19:11866917-11866939 CTCAGGAGGCTGAGACATGAGGG + Intronic
1162771785 19:12953644-12953666 CCCAGCAGGCACAGACCATAGGG - Exonic
1163212201 19:15849413-15849435 CTCAGGAGGCAGAGGCAGGAGGG - Intergenic
1163286637 19:16352569-16352591 CTCAGGAGGCTGAGACAAGGAGG - Intergenic
1163352413 19:16786216-16786238 CCCAGGAGTCCGAGACAAGCCGG - Intronic
1163630017 19:18413553-18413575 CCCAGAAAACAGACCCAAGATGG + Intergenic
1163804584 19:19387730-19387752 CCCAGAAGAAATAGAAAAGAAGG - Intronic
1164605987 19:29598498-29598520 CTCAGAAGGCTGAGACGGGAGGG - Intergenic
1164639409 19:29812830-29812852 CCCCGTAGGCAGAGCCAAGTCGG - Intronic
1164795393 19:31023027-31023049 CCTAGAAGACAGAAACCAGATGG + Intergenic
1165976254 19:39679318-39679340 GCCAGAGGGCAGGGCCAAGAGGG + Intergenic
1166784923 19:45361999-45362021 CCCAGGAGGCGGAGTCGAGATGG - Intronic
1167221527 19:48202019-48202041 CCCATAAGGTAAAGAGAAGATGG + Intronic
1168572060 19:57479298-57479320 GCCAGGAGGCTGAGAAAAGAGGG - Intergenic
925366203 2:3313854-3313876 CGAGGAAGGCAGAGGCAAGAGGG + Intronic
926613276 2:14969482-14969504 CCCAGGAGGCTGAGGCAGGAGGG - Intergenic
926631199 2:15137881-15137903 CTCAGTGGGCTGAGACAAGAGGG - Intergenic
926844008 2:17113610-17113632 ACAAGAAGGCAGACACAAGGAGG - Intergenic
926888815 2:17621733-17621755 CCCAGAAGGCAGAGACAAGAGGG - Intronic
927301141 2:21516618-21516640 TCCAGAAGACAGATGCAAGAAGG - Intergenic
927831377 2:26353672-26353694 TGCAGTTGGCAGAGACAAGAAGG + Intronic
927992497 2:27458016-27458038 CCCAGAAGGCAGTGATAGCAGGG - Intronic
928087141 2:28352932-28352954 CCCAGAAGGGAGGGAGAAGAAGG + Intergenic
928108955 2:28490983-28491005 CCCAGCAGTGAGGGACAAGAGGG - Intronic
928115240 2:28541547-28541569 CCCTGAAGGGTGAGACAAGAGGG + Intronic
928456808 2:31429857-31429879 CCAAGAAGGAAGAGTCAGGAAGG + Intergenic
928517708 2:32059749-32059771 CTCAGGAGGCTGAGGCAAGAGGG + Intergenic
928741888 2:34364263-34364285 CCCTGAAGGTACAGATAAGAAGG + Intergenic
928786957 2:34899655-34899677 GACTGAAGGCAGAGGCAAGAGGG - Intergenic
929041115 2:37745679-37745701 CCCAGAAGGTAGGGAGGAGAGGG - Intergenic
929771558 2:44896611-44896633 CCCAGGAGGCAGAGAGCTGAGGG + Intergenic
930615128 2:53585568-53585590 ACCAGAGGGAAGAGACAAGGAGG - Intronic
930748390 2:54908005-54908027 CACAGCAGGCAGAGAGAAAAAGG + Intronic
930784008 2:55252637-55252659 CCCAGAAGGCAGAGAGACTGTGG + Exonic
931067631 2:58604687-58604709 CACAGCAGGCAAAGAGAAGAGGG - Intergenic
931234009 2:60398311-60398333 CCCAGAAGGGAAACACCAGAAGG - Intergenic
931678270 2:64719715-64719737 CCCACGAGGCAGGGACAAAAAGG + Intronic
931967733 2:67551969-67551991 CCCAAAGTGCAGCGACAAGAAGG + Intergenic
932275265 2:70446774-70446796 CCCAGAGGGCAGAGAGAGTATGG + Intergenic
932380581 2:71278035-71278057 CCTAGAAACCAGAGCCAAGAAGG - Intronic
932533463 2:72564658-72564680 CCCAAAATTCAGAGAAAAGAAGG + Intronic
932635337 2:73383350-73383372 CTCAGGAGGCTGAGGCAAGAGGG - Intergenic
932879534 2:75488280-75488302 TCCAGAAGGCAGAGAGAACAGGG + Intronic
932897258 2:75652709-75652731 CCCAGGATGCAGAAACAAAAAGG - Intronic
933654616 2:84877442-84877464 CCCAGAAGGAAAAGACAACCGGG + Intronic
933905283 2:86885717-86885739 CCAAGAAGACAAAGAAAAGAAGG - Intergenic
933943876 2:87267692-87267714 TCCACATGGAAGAGACAAGAAGG - Intergenic
934122549 2:88854149-88854171 CCAAGGAGGCAGAGACCAGAGGG - Intergenic
934711021 2:96514074-96514096 CCCAGGAGGCAGAGGCTACAGGG + Intergenic
935081590 2:99802553-99802575 CTCAGGAGGCTGAGGCAAGAGGG + Intronic
935123710 2:100203807-100203829 CTCAGAGGGCAGAGGCAAGACGG - Intergenic
935730575 2:106062015-106062037 CCTTGGAGGCAGAGTCAAGATGG + Intergenic
936010092 2:108919997-108920019 TGCAGAAGGCAGAGGCAAGAGGG - Intronic
936282888 2:111158196-111158218 CACAGAAGTCAGAGAGAAAAAGG - Intronic
936336344 2:111593887-111593909 TCCACATGGAAGAGACAAGAAGG + Intergenic
936564343 2:113571558-113571580 CCAAGGAGGTAAAGACAAGAGGG + Intergenic
937093734 2:119223195-119223217 CCCAGAAGGCCTAGACAGGGAGG + Intergenic
937128104 2:119487384-119487406 ACCAGCAGGTAGAGACAAGAAGG + Intronic
937139336 2:119585938-119585960 CCCAGAAGGTAGAGCCCAGCTGG + Intronic
939612989 2:144332453-144332475 GCCAGGAGGGAGAGACAAGGAGG - Intronic
941394958 2:164962912-164962934 GCCAGAATGCAGAGACATGATGG + Intergenic
942256971 2:174112707-174112729 AGCAGAAGGCAGAAACAAGTGGG - Intronic
942479000 2:176362193-176362215 CCCAAATGGCATAGAAAAGAGGG + Intergenic
942505175 2:176634424-176634446 CTCAGAAGGCAAAGTCTAGATGG + Intergenic
942651424 2:178172784-178172806 CTCAGGAGGCTGAGACAGGAGGG - Intergenic
943250861 2:185519346-185519368 CCCAGGGGACAGGGACAAGATGG - Intergenic
943255831 2:185591890-185591912 CCTAGAAGGAGGAGCCAAGATGG - Intergenic
943763734 2:191637749-191637771 CAGAGAAGGGAGAGACATGAAGG + Intergenic
943983188 2:194582872-194582894 ACCAGAAGCAAGAGACCAGAAGG - Intergenic
944367040 2:198933418-198933440 CCCAGAGGGGAGAAAGAAGAAGG + Intergenic
944408526 2:199413471-199413493 CAGAGAAGGCAGAGAGCAGAGGG - Intronic
944903989 2:204244336-204244358 ACCAGAAGGAAGAAACAAAAGGG + Intergenic
944927272 2:204478273-204478295 CTCGGAAGGCTGAGGCAAGAGGG - Intergenic
946023437 2:216657424-216657446 CCCAGAGGTCAGAAACAAAAGGG - Intronic
946359281 2:219209395-219209417 CCTGGAGGGCAGAGACAAGCGGG + Exonic
947194438 2:227546608-227546630 CCCAGAAGGGAGTTCCAAGATGG - Intronic
947219518 2:227779173-227779195 ACCAGAAGGAAAAGAGAAGATGG + Intergenic
947267098 2:228294949-228294971 ACCAGGAGGGAGAGTCAAGATGG + Intergenic
947393269 2:229661952-229661974 TCCAGCAGGCAGCCACAAGAAGG + Intronic
947615175 2:231551519-231551541 CCCAGAAGGCAGGGAGCAGAAGG + Intergenic
947812214 2:233011693-233011715 CTCAGGAGGCAGAGGCAGGAGGG - Intronic
947899326 2:233707206-233707228 CACAAAAGTCAGAGAAAAGATGG - Intronic
948726736 2:239938790-239938812 CCCAAACGGCACAGAGAAGACGG + Intronic
948846359 2:240684514-240684536 CCCAGAAGGCAGAGAAACCCCGG + Intergenic
1170003547 20:11641497-11641519 CCCAGAATGCAGAGCAAAGCAGG + Intergenic
1170661025 20:18340257-18340279 ACCAGAAGGCAAGGACATGAGGG - Intergenic
1170743237 20:19076048-19076070 CACAGAAGCCAGACACAAAAGGG - Intergenic
1171055065 20:21898586-21898608 CCCAGGAAAGAGAGACAAGATGG - Intergenic
1172493365 20:35359767-35359789 CCAAGAAAGCAGAGCCTAGATGG + Intronic
1172600161 20:36177791-36177813 CTCAGAGGGCAGAGCCAAGTGGG + Intronic
1172915292 20:38439029-38439051 CCCAAAAGGGAGAGACAGGGAGG + Intergenic
1173037542 20:39427231-39427253 CTCAGGAGGCTGAGACAGGAGGG - Intergenic
1173527272 20:43742843-43742865 TCTAGAAGACAGAGACCAGAAGG - Intergenic
1173900195 20:46582043-46582065 TTCAGAAGGCAGAGACGGGAGGG + Intronic
1174102514 20:48138330-48138352 CCCAGAAGCCAGAGGCCACAAGG - Intergenic
1174310102 20:49646089-49646111 CTCAGGAGGCTGAGGCAAGAGGG + Intronic
1174666761 20:52265287-52265309 CCCAGAAACCAGAGAAAGGAGGG + Intergenic
1175044207 20:56089004-56089026 CCCAAAAGGGACAGACAGGATGG - Intergenic
1175116418 20:56685787-56685809 CCCAGAAGCCAGAGACAGGAAGG - Intergenic
1175169145 20:57067764-57067786 AACAAAAGGCAGAGAGAAGAGGG - Intergenic
1175190942 20:57211770-57211792 CCTAGAAGCCAGAAACAACAAGG + Intronic
1175337045 20:58203470-58203492 CCCACAGGGCACAGACAACAGGG - Intergenic
1175411944 20:58776300-58776322 CCGAGCAGGCAGAGAGAAGGTGG - Intergenic
1175499670 20:59440939-59440961 CCCAGAAAGGAGAGACTAGGGGG - Intergenic
1175743198 20:61435322-61435344 GCCACAAGGCAGAGAAAGGAGGG + Intronic
1176124743 20:63470468-63470490 CTCAGGAGGCAGAGACAGGAAGG + Intronic
1176218703 20:63959941-63959963 TCCAGGATGCAGAGACAAGGGGG - Exonic
1176523466 21:7845999-7846021 CTCAGAAGGCTGAGGCAGGAGGG + Intergenic
1176995632 21:15552269-15552291 CTCAGGAGGCTGAGACAGGAGGG - Intergenic
1177245731 21:18520642-18520664 CCCAGGAGGAAGAAACAATATGG - Intergenic
1178291350 21:31371312-31371334 CCCAGAATGCAAAGGCAGGAAGG + Intronic
1178305055 21:31484451-31484473 CCCCGGAGGCAGAGGCAAGCTGG - Intronic
1178372369 21:32037201-32037223 CCCAGTAAGCAAAGACATGAAGG - Intronic
1178411777 21:32369565-32369587 CCCAGGAGGCTGAGGCAGGAGGG - Intronic
1178419930 21:32435294-32435316 CTCAGGAGGCTGAGACAGGAGGG - Intronic
1178657486 21:34476011-34476033 CTCAGAAGGCTGAGGCAGGAGGG + Intergenic
1178661551 21:34511211-34511233 CTCAGGAGGAAGAGACCAGAAGG - Intergenic
1178882321 21:36459478-36459500 CCCAGACTGCAGAGAATAGAGGG + Intergenic
1179408729 21:41145828-41145850 CTCAGAAGGCTGAGGCAGGAGGG - Intergenic
1180198969 21:46213507-46213529 CCCAGAAGGTAGAGTGAGGAAGG - Intronic
1180479507 22:15738525-15738547 CACAGAAGGCAGAGTCCCGAGGG - Intergenic
1180608345 22:17078768-17078790 TCCAGGAGGCTGAGGCAAGAGGG + Intergenic
1180938065 22:19638848-19638870 CCCAGAAAGCTGAGGCAAGGTGG + Intergenic
1181323398 22:22025839-22025861 CCCAGAAAGCACAGAGCAGAGGG - Intergenic
1182787557 22:32920327-32920349 CCCACAAGGGAGAGATAAAAAGG - Intronic
1183073524 22:35412404-35412426 CCCAGAAGGCAGAGCCCTTAGGG - Intronic
1183226651 22:36554810-36554832 CCCAGGAGGCTGAGGCAGGAGGG - Intergenic
1183243153 22:36673273-36673295 CCCAGAAAGCAAAGACAGCAAGG + Intronic
1183952593 22:41359866-41359888 CCCGGCAGGCAGGGACAAGATGG + Exonic
1184005496 22:41705245-41705267 CCCAGGAGGCAGAGATTACAAGG - Intronic
1184117024 22:42428186-42428208 CCCAAAAGGCAGGGCCAGGAGGG - Intronic
1184696510 22:46142372-46142394 CTCAGGAGGCAGAGGCAGGAGGG + Intergenic
1184790535 22:46696882-46696904 CCCAGCAGGCAGGGACAGGGAGG + Intronic
1184877078 22:47282757-47282779 CCCAGAAGACAGAGTCGCGACGG - Intergenic
1203293381 22_KI270736v1_random:17250-17272 CCCAGAAGGTAGGGAGGAGAAGG - Intergenic
949941668 3:9159393-9159415 CCCAGGTGGCAGAGATAAGAAGG - Intronic
950598165 3:14004609-14004631 CTCAGGAGGCTGAGACAGGAGGG - Intronic
950645232 3:14373062-14373084 GACAGCAGGCAGAGACAAGATGG - Intergenic
951916188 3:27803314-27803336 CTCAGGAGGCTGAGGCAAGAGGG - Intergenic
952119521 3:30225627-30225649 GCTAGAAGGCAGAAACATGATGG + Intergenic
954022281 3:47752680-47752702 CCCAGTAGGCTGAGTCAGGAGGG + Intronic
954792569 3:53144076-53144098 CACTGAAGCCAGAGAGAAGAGGG - Intergenic
955508377 3:59654843-59654865 CCCAAAATGCAGAGATAATAAGG + Intergenic
955805278 3:62727327-62727349 AAGAGAAGGCAGACACAAGAGGG + Intronic
956012375 3:64845323-64845345 CCCAGAAGCGAGAGAGAACATGG - Intergenic
956711332 3:72041109-72041131 CCCAGAAGCCAGAGGCAAACAGG + Intergenic
956819497 3:72940787-72940809 CTCAGGAGGCTGAGACAGGAGGG - Intronic
956918422 3:73899687-73899709 CCCAGATGACAGAGAGAAGAAGG - Intergenic
958551188 3:95615627-95615649 CCTAGAATGTAAAGACAAGAAGG - Intergenic
959943442 3:112103558-112103580 CCCTGAAGGCACAGACAATGTGG - Intronic
960812612 3:121638936-121638958 CTCAGAAGGCTGAGGCAGGAGGG + Intronic
960815046 3:121663502-121663524 CACAGAGGGCAGAGACAATGGGG + Exonic
961484387 3:127206971-127206993 CCCAAGAGGCAGAGAGAGGAGGG - Intergenic
962184378 3:133242986-133243008 CCCAAAAGGCAGAGAAACAAGGG + Intronic
962843960 3:139259217-139259239 CCCAGATGGCAGAGAGAGGCTGG - Intronic
962896968 3:139724280-139724302 GCCAGAAGGGAAAGAAAAGAGGG - Intergenic
963014888 3:140813406-140813428 TCCAGAAGATAGAAACAAGAGGG + Intergenic
963084080 3:141420860-141420882 CTCAGCAGGCAGAGAAAGGATGG + Intronic
963093105 3:141505065-141505087 CCCAGAGGGTAGAGACAGGGAGG - Intronic
963203739 3:142611512-142611534 CTCAGGAGGCTGAGACAGGAAGG + Intronic
963783364 3:149509308-149509330 CACAGAAGGCAGAGATCACAGGG - Intergenic
964473289 3:157076622-157076644 CCCAGAACGTAGAGACCAGCAGG - Intergenic
964750426 3:160049157-160049179 CTCAGGAGGCTGAGACAGGAGGG - Intergenic
965779673 3:172271633-172271655 CCCAGCTGGCAGAGCCAAGTGGG - Intronic
966239808 3:177743767-177743789 CCCAGAAAGCAGGGGCATGATGG - Intergenic
966706872 3:182925892-182925914 CCCAGAAGGCAGGGACCATTGGG + Intergenic
967110217 3:186286463-186286485 CCTAGAAGGAAGGCACAAGAAGG - Intronic
967201273 3:187074577-187074599 GCCAGAAGGGAGAGACAACCTGG + Intronic
967857167 3:194127018-194127040 ATCAGAAGGGAGAGACATGAGGG - Intergenic
968276992 3:197447394-197447416 CCCTTGTGGCAGAGACAAGAAGG + Intergenic
968290781 3:197538054-197538076 CTTAAAAGGCAGAGAGAAGAAGG - Intronic
968453050 4:684069-684091 CCCAGAAGGCAGAGGGCAGAGGG + Intronic
968959453 4:3735495-3735517 CCCAGCAGGAGGGGACAAGACGG + Intergenic
970423857 4:15928975-15928997 CCCCCAAAGCACAGACAAGAAGG + Intergenic
970523059 4:16904627-16904649 GCCTGAAGGCAGACACTAGATGG - Intergenic
971755055 4:30696810-30696832 TGCAGGAGGCAGAGGCAAGAGGG + Intergenic
971870922 4:32237460-32237482 CCCAGAAGGCAGAGTGAACTAGG + Intergenic
972002106 4:34050443-34050465 CACAGAAGCCAGAGATAAAATGG - Intergenic
972357314 4:38292135-38292157 ATCTGAAGGCAGAGACAAAATGG - Intergenic
974277849 4:59749154-59749176 ACCAGTAGGCAGAGAGAAGGAGG + Intergenic
975103329 4:70539567-70539589 CCCAAAATGCAGAGGAAAGAAGG - Intergenic
975328440 4:73086694-73086716 CTCAGGAGGCTGAGGCAAGAGGG - Intronic
976067731 4:81208527-81208549 CTCTGAAGGCTGAGGCAAGAGGG - Intronic
976616080 4:87078627-87078649 CACAGATGGAAGAGAGAAGAGGG + Intronic
977141042 4:93372525-93372547 CCCAGAAAAAAGAGAAAAGAAGG - Intronic
978849631 4:113317825-113317847 TCCAGAAAGCAAAGACATGAAGG - Intronic
979737541 4:124105494-124105516 CCCAGATTCCAGAGAGAAGAAGG - Intergenic
982222357 4:153135829-153135851 CTCAGGAGGCTGAGGCAAGAGGG + Intergenic
982731689 4:158963054-158963076 CCCAGAAAGCAGAGATACTAGGG - Intronic
983267729 4:165524794-165524816 CCTACAGGGCAAAGACAAGAAGG - Intergenic
984973413 4:185209895-185209917 CCCTGAAGCCCGAGACAGGACGG - Intronic
985664621 5:1175549-1175571 GGGAGAAGGCAGAGACCAGAGGG - Intergenic
985885287 5:2672786-2672808 GCCAGTAGGGAGAGACAAGAGGG - Intergenic
986185279 5:5429953-5429975 CCCAGAAGGCAAAGAAAAGATGG + Intronic
986290275 5:6394210-6394232 CCCAGAAGACATCGACAGGATGG + Intergenic
987556960 5:19464918-19464940 CTCAGAAGGCTGAGGCAGGAGGG - Intergenic
988052495 5:26049184-26049206 CCAAGAAGGCACCGGCAAGATGG - Intergenic
988283450 5:29180160-29180182 CCAAGAAAGAAGAAACAAGAAGG + Intergenic
988326824 5:29779361-29779383 CCATAAAGGCAGAGAGAAGATGG + Intergenic
989342210 5:40388564-40388586 CCAATCAGGCAGAGAGAAGAAGG - Intergenic
990188195 5:53230263-53230285 TCCAGAGGGCGGAGCCAAGATGG - Intergenic
990492240 5:56313897-56313919 CCCAGGAGCCAGAGGCAGGAGGG + Intergenic
992126696 5:73649800-73649822 CCAAGTAGCCAGAGAAAAGACGG + Intronic
992458371 5:76937643-76937665 CTCAGGAGGCTGAGACAGGAGGG + Intergenic
992612038 5:78516323-78516345 CCCAGAAGTCAGAGATGGGATGG - Intronic
992802757 5:80308734-80308756 ACCATAAGGAACAGACAAGATGG - Intergenic
993001180 5:82382280-82382302 CCCAGGAGTTAGAGACCAGATGG + Intronic
993006668 5:82435405-82435427 CACAGAAGGAGGAGCCAAGATGG - Intergenic
993090949 5:83426017-83426039 CCCAGAAGGAAGGGAGAAGAGGG - Intergenic
994057855 5:95439909-95439931 CCCAGGAGGCTGAGGCAAGCAGG + Intronic
994310427 5:98262763-98262785 CCCAAAAGCCAGAGAAAGGAAGG + Intergenic
994397500 5:99237615-99237637 CCCAGGAGACAGAGAGAAGGGGG + Intergenic
994522762 5:100862472-100862494 CCCAGGAGGCGGAGATAGGAGGG - Intronic
994592797 5:101792882-101792904 CACATAAGACAGAGAAAAGACGG + Intergenic
995622198 5:114039004-114039026 CCCAGAATGGGGAGCCAAGATGG + Intergenic
995844301 5:116477567-116477589 CCCTGGAGAGAGAGACAAGAAGG - Intronic
997084585 5:130783487-130783509 CCCAGAGGGTGGAGCCAAGATGG + Intergenic
997996467 5:138590725-138590747 CCCCGAAGGCTGAGGCAGGAGGG - Intergenic
998327735 5:141296826-141296848 TCCAGATGGCAAAGAGAAGAGGG + Intergenic
998938907 5:147259913-147259935 GCCAGGAGTGAGAGACAAGAGGG - Intronic
998973176 5:147614874-147614896 CCCAGAAGACAGGGACAGCAAGG - Intronic
999087951 5:148910282-148910304 GGCAGAAGTCAGAGACAAGTGGG + Intergenic
999670704 5:153956968-153956990 TCGGGAAGGCAGAGACAAGAGGG - Intergenic
999821733 5:155235339-155235361 GCCAGAAGGAAAAGACAATAGGG - Intergenic
999895699 5:156031033-156031055 CTCAGTAGCCAGAGACAAGTGGG + Intronic
1002030187 5:176422764-176422786 CTCAGAAGGCTGAGGCAGGAGGG - Intergenic
1002785229 6:394847-394869 CCGAGAAGGCATCGACAAGCCGG + Exonic
1002976180 6:2079907-2079929 CCCAGAAGACAGAGAACAAAAGG - Intronic
1004054976 6:12126963-12126985 CTCAGGAGGCTGAGACAGGAGGG - Intronic
1004365191 6:15006841-15006863 CTCAGGAGGCTGAGACAGGAGGG + Intergenic
1004469913 6:15920158-15920180 CCCTGAAGGGAGAGAAAAAATGG - Intergenic
1004947410 6:20630761-20630783 ACCAGAAGGCAGTGCCAGGATGG - Intronic
1005082075 6:21966187-21966209 ACCAGCAGGAAGAGAAAAGATGG + Intergenic
1005103915 6:22202992-22203014 CACAGAAGACAGGGAGAAGATGG + Intergenic
1005301730 6:24477620-24477642 CTCAGAAGGCTGAGGCAGGAGGG + Intronic
1005414877 6:25589257-25589279 TCCAGAAGACTGAAACAAGATGG - Intronic
1006651021 6:35551650-35551672 GCCAGAGGGCAGAGGGAAGATGG + Intergenic
1006925264 6:37650456-37650478 GCCAGAAGGCAGAGCCCAGTGGG - Intronic
1007566398 6:42854304-42854326 CCCAGAAGGCTGAGGCAGGAGGG - Intronic
1008600639 6:53090786-53090808 CTCAGGAGGCTGAGGCAAGAGGG - Intronic
1010317457 6:74467358-74467380 CCCAGAAGGAGGAGTCAACATGG - Intergenic
1011278726 6:85655566-85655588 CTCGGAAGGCTGAGACAGGAGGG + Intergenic
1011389244 6:86833547-86833569 TCCAGAAAGCATAGAAAAGAGGG - Intergenic
1011392440 6:86868401-86868423 CTCTGAAACCAGAGACAAGAAGG + Intergenic
1012550511 6:100461047-100461069 CACAGAAGGGAGAGAAAGGAGGG + Intronic
1012915694 6:105168137-105168159 CCCTGTAGGCAGAAACCAGATGG - Intronic
1013237981 6:108215608-108215630 CCCAGAAGGGAGAGATCAGCAGG - Intronic
1013582306 6:111548188-111548210 CCAAGAAGGAAAAGTCAAGAGGG - Intergenic
1013643558 6:112112387-112112409 TCCCGAAGGCAGGGACAAGGAGG + Intronic
1014168224 6:118249758-118249780 CTCAGAAGACATAAACAAGAGGG - Intronic
1014619464 6:123647763-123647785 CATAGATGGCAGTGACAAGATGG - Intergenic
1015038874 6:128692013-128692035 CCCTGAAGGAAGTCACAAGAAGG - Intergenic
1015602261 6:134921943-134921965 CCCAAAGGGCAGAGACAGCAGGG + Intronic
1015848045 6:137542338-137542360 CAAAGAAGACAGAGACAAAAGGG + Intergenic
1016016678 6:139193584-139193606 ACCAGAGAGCAGAAACAAGAGGG + Intergenic
1016139043 6:140585723-140585745 ATGAGAAGGCAGAGCCAAGATGG + Intergenic
1016571206 6:145515112-145515134 CTCAGTAGCCAAAGACAAGAAGG + Intronic
1016663090 6:146604022-146604044 ACCAGAAGGCAGAGCTAAGAAGG + Intronic
1017006381 6:150030526-150030548 CCCAGAAGCCACAGGCAGGATGG - Intergenic
1018734502 6:166677466-166677488 CTCGGAAGGCTGAGGCAAGAGGG - Intronic
1019314484 7:378127-378149 CCCAGGAGGCTGAGGCAGGAGGG - Intergenic
1019337252 7:491282-491304 CCTAGAAGTCAGAGTCAAGGAGG + Intergenic
1019499841 7:1359310-1359332 CCTAGGAGCCAGAGACAAGGTGG - Intergenic
1019919425 7:4153782-4153804 CCCGGGAGGCTGAGACAGGATGG - Intronic
1021285423 7:18775895-18775917 CAAAGAAAGCTGAGACAAGAAGG - Intronic
1021896769 7:25243886-25243908 CCCAGAAGCTAGAAACTAGAAGG - Intergenic
1022168284 7:27795626-27795648 CCCAGAAGGCAGAGGCTGCAGGG - Intronic
1022620145 7:31975150-31975172 GGCAGAAGGCAGAGAGAACAGGG - Intronic
1022665215 7:32404459-32404481 CCCAGGAGGCAGAGGCAGGAGGG - Intergenic
1023576643 7:41635317-41635339 GCCAGACTACAGAGACAAGATGG - Intergenic
1024050747 7:45621651-45621673 GCCAGCAGGCAGGGACAGGAGGG - Intronic
1024577910 7:50779969-50779991 CCGAGGAGGCAGAGAAAAAAAGG + Intronic
1024640684 7:51326298-51326320 CCCAGAAGGCTGCAACAAGAAGG - Intergenic
1025843688 7:65176254-65176276 CCCAAAAAGGAGAGAGAAGATGG - Intergenic
1025894083 7:65682876-65682898 CCCAAAAAGGAGAGAGAAGATGG - Intergenic
1026907986 7:74074000-74074022 CAAAGAAGGCAGAGACAGGCTGG - Intergenic
1026987850 7:74565874-74565896 CCCAGGAGGCTGAGGCAGGAGGG + Intronic
1028612786 7:92731064-92731086 CCCAGAATGCAGACAAAAGTGGG - Intronic
1029309504 7:99649247-99649269 CCCTGAAGCCATAGATAAGATGG + Intronic
1029513220 7:101009785-101009807 CCCAGAGGGGAGAGAGAGGAGGG + Intronic
1029548798 7:101225587-101225609 CTCAGAAGGCTGAGGCATGAGGG - Intergenic
1029572485 7:101379387-101379409 CCCATCAGGCAGAGCCAGGACGG - Intronic
1029957952 7:104659370-104659392 CCCAGGTTGCAGAGCCAAGATGG + Intronic
1031697484 7:124876506-124876528 CTCAGAAGGCAGAGTTCAGAAGG - Intronic
1031984596 7:128155325-128155347 CCTGGAAGGCAGAGAGGAGAGGG + Intergenic
1032398490 7:131607714-131607736 CCCAGGAGGCAGACAGAAGGTGG + Intergenic
1032447484 7:131997018-131997040 TCCAGAAGCCAGAGAGAAAAGGG - Intergenic
1034876232 7:154726986-154727008 CTCAGAAGACAGAGAGATGAGGG - Intronic
1034893310 7:154859092-154859114 CCCAGATGGCAGCGACGTGAAGG - Intronic
1034965557 7:155388636-155388658 CCCAGCAGGCCCAGACTAGAAGG - Intronic
1035546578 8:486389-486411 CCCAGTAGCCACAGCCAAGAAGG - Intergenic
1036618539 8:10406951-10406973 CCCAGAAGGCTGAGGCCACAGGG - Intronic
1036935312 8:12996562-12996584 CCCAGAAGGCACTGACTGGATGG + Intronic
1037050154 8:14362492-14362514 CCCAAAAGCCAGGCACAAGAGGG + Intronic
1037393234 8:18416427-18416449 CCCAGAGGGCAGAGGCTAGGGGG - Intergenic
1037908080 8:22727219-22727241 CCCTGAAAGAAGAGACAAGCAGG + Exonic
1038477505 8:27878306-27878328 CCCAGAATGCAGAAGCAACAGGG + Intronic
1038579974 8:28739432-28739454 CCCAGGAGACAGAGGCAGGAGGG - Intronic
1039626721 8:39061768-39061790 CCCAGAGGGCAGAGCCATCATGG + Intronic
1039738829 8:40361063-40361085 CCCAGAAGGAAGAGAAAACCAGG + Intergenic
1039834230 8:41243707-41243729 ACCAGAAGGCAGAGAGAGGCGGG + Intergenic
1040962996 8:53054270-53054292 CCCAAAAGGCAGAGAGAAGAAGG - Intergenic
1041478695 8:58294567-58294589 TCTAGAAGGCTGAGGCAAGAGGG - Intergenic
1043177421 8:77039920-77039942 CCCAGTTGCCAGAGAAAAGAGGG - Intergenic
1043440625 8:80274128-80274150 CCCAGAAGTTAGAGACCAGCTGG - Intergenic
1043476360 8:80609584-80609606 CTCAGGAGGCTGAGACAAGAAGG - Intergenic
1043979206 8:86618534-86618556 TCCAGAGGGCAGAAACAACATGG + Intronic
1045248608 8:100464725-100464747 AGCAGAAGGAAGAGACAAGGAGG + Intergenic
1046644295 8:116767977-116767999 CACAGGAGGCTGAGACAGGAGGG + Intronic
1047360789 8:124167045-124167067 CCTGGAAGGTAGAGAGAAGATGG - Intergenic
1047727743 8:127698720-127698742 CCCAGAAGGCACAGAGGAGGTGG + Intergenic
1048479507 8:134775454-134775476 CCCAAAAGGTAGAAACATGAAGG - Intergenic
1049121675 8:140745199-140745221 CGGAGAAAGCAGGGACAAGAAGG + Intronic
1049351089 8:142165197-142165219 CCCAGCAGGCAGGGCCAGGATGG - Intergenic
1049500194 8:142958933-142958955 CCCCGAAGGCAGAGACCAAAAGG - Intergenic
1049637116 8:143694966-143694988 CGCCCAAGACAGAGACAAGAAGG - Exonic
1049888083 9:41649-41671 CCAAGGAGGTAAAGACAAGAGGG - Intergenic
1049991528 9:996170-996192 CCCTGAAGGCAGAAGCAATAAGG - Intergenic
1051176829 9:14369467-14369489 CCCAGAAGGCATCAACAACATGG - Intronic
1051193303 9:14536694-14536716 CCATGAAGGCAGGGACAAGAAGG + Intergenic
1051623437 9:19075847-19075869 CTCAGGAGGCTGAGGCAAGATGG + Intronic
1053402468 9:37837914-37837936 CTCAGGAGGCTGAGACAAGGAGG + Intronic
1053457789 9:38244316-38244338 CCCAGAAGCCAAAAACAAGAGGG + Intergenic
1053557756 9:39155528-39155550 ACCAGCAGGCTGAGAAAAGAAGG + Intronic
1054139357 9:61463423-61463445 ACCAGCAGGCTGAGAAAAGAAGG - Intergenic
1055276096 9:74618517-74618539 CCAGGACGGCAGAGAAAAGAAGG - Intronic
1055461217 9:76522165-76522187 CTCAGAAGGCTGAAGCAAGAGGG + Intergenic
1056108891 9:83375059-83375081 CCCTGGAGTCAGAGACAAGTTGG - Intronic
1056455602 9:86756632-86756654 CACTGAAGGATGAGACAAGAGGG - Intergenic
1056720818 9:89070326-89070348 TCCAGAAGGGAGAGGGAAGAAGG - Intronic
1058661932 9:107274480-107274502 CTCAGGAGGCTGAGACAGGAGGG - Intergenic
1058758110 9:108102561-108102583 CCAAGAAGTCAGATACAATAAGG + Intergenic
1059468003 9:114481595-114481617 AGCAGGAGGCAGAGACGAGAGGG - Intronic
1060254590 9:122015945-122015967 TCCACAAGGCAGTGACCAGATGG - Intronic
1060495412 9:124114926-124114948 CTCAGAAGCCAGTGACAAGGGGG + Intergenic
1060553280 9:124495661-124495683 CCCAGAACGAAGACACAAGGGGG + Intronic
1061466847 9:130787326-130787348 CACAGAAGGCAGAGTCCAGGTGG - Intronic
1062356566 9:136167369-136167391 TCAAGAAGGCAGAGGGAAGATGG - Intergenic
1062400962 9:136372441-136372463 TCCAGGAGGCAGAGGCCAGAGGG - Intronic
1186128938 X:6445511-6445533 AGCAGAAGCCAGAGGCAAGATGG + Intergenic
1186138455 X:6545477-6545499 CCCAGAAGCCAGAAGCAAGTGGG - Intergenic
1187190450 X:17029943-17029965 AGAATAAGGCAGAGACAAGATGG - Intronic
1187811294 X:23180403-23180425 CCCAGAAGGCATATAGAAAATGG - Intergenic
1189309756 X:40010965-40010987 GCCAGGAGGCAGGGACAAAAGGG + Intergenic
1189437783 X:41008069-41008091 CTCAGGAGGCTGAGACGAGAGGG + Intergenic
1189440251 X:41029587-41029609 CCCAGGAGGCAGAGACTGCAGGG - Intergenic
1189498424 X:41530499-41530521 CCCAGATGTCAGAGACAGCAGGG - Intronic
1191080808 X:56507689-56507711 TCCACAAGGTAGAGACAAAAAGG + Intergenic
1191146422 X:57170585-57170607 CTCAGAAGGCAGAGTGTAGAAGG - Intergenic
1191994612 X:67079265-67079287 CCCAGAGGCCAAAGACAAAAAGG - Intergenic
1192867831 X:75154603-75154625 CCCACAAGTCAGAGAGAACATGG - Intronic
1193455752 X:81729627-81729649 CCCACAAGGCAGACACCACATGG - Intergenic
1194038572 X:88911672-88911694 ATCAGGAGGCTGAGACAAGAGGG + Intergenic
1194137163 X:90160677-90160699 CTCTGAAACCAGAGACAAGAAGG - Intergenic
1195129993 X:101841997-101842019 CAGAGAAGGGAGAGACAACATGG + Intronic
1196053526 X:111331024-111331046 CCCAGAATGCCGAGTCATGAAGG - Exonic
1196674257 X:118402638-118402660 CTCAGAAGGCAGAGGCAGGTGGG + Intronic
1196752175 X:119127939-119127961 CCCAGAAGGAACAGCCAATAAGG - Intronic
1197579617 X:128264895-128264917 GCCAGAAAGCAGAGACATAAAGG + Intergenic
1198083079 X:133257394-133257416 CCCAGAAGTTAGAGACCAGCAGG + Intergenic
1198716999 X:139568026-139568048 GACAGAAAGCACAGACAAGAGGG - Intergenic
1199688158 X:150282696-150282718 TCCATAAGGTAGAGAGAAGAAGG + Intergenic
1199768261 X:150956404-150956426 CAGAGAAGGCAGAGTGAAGAGGG - Intergenic
1200482898 Y:3730601-3730623 CTCTGAAACCAGAGACAAGAAGG - Intergenic
1201708702 Y:16965853-16965875 CATAGAAGGCAAAGACAAGTAGG + Intergenic